View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11936_high_8 (Length: 306)

Name: NF11936_high_8
Description: NF11936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11936_high_8
NF11936_high_8
[»] chr2 (2 HSPs)
chr2 (135-295)||(2696763-2696924)
chr2 (49-139)||(2694114-2694204)


Alignment Details
Target: chr2 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 135 - 295
Target Start/End: Original strand, 2696763 - 2696924
Alignment:
Q  135 tccttgcttctcatctctcgcgtttcattcagttcaactaatgtcagatttccttttcagttttctttcatatacttttgtggtgataaaaaattcctac 234  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| ||||||||    
T  2696763 tccttgcttctcatctctcgcgtttcattcagttcaactaatgtcagatttgcttttcagtttgctttcatatacttttgtggtgataaaatattcctac 2696862  T
Q  235 acttatgacatattccgttttac-tatgtttgatttgcatctgcttagtgtgtcctgttcat 295  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  2696863 acttatgacatattccgttttacttatgtttgatttgcatctgcttagtgtgtcctgttcat 2696924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 49 - 139
Target Start/End: Original strand, 2694114 - 2694204
Alignment:
Q  49 taattgtcgttttagattgttcatagtttttaaggaaatgattagttgggttgattcctattactttcacatcgcctacctccttctcctt 139  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||    
T  2694114 taattgtcgttttagattgttcatagtttttaaggaaatgattagttgagttgattcctattactttcacatcgcctaccttcttctcctt 2694204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University