View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11931_low_6 (Length: 275)

Name: NF11931_low_6
Description: NF11931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11931_low_6
NF11931_low_6
[»] chr1 (1 HSPs)
chr1 (18-191)||(9025551-9025727)


Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 18 - 191
Target Start/End: Complemental strand, 9025727 - 9025551
Alignment:
Q  18 tgaccagcttttgcatgttctactcaatctatcaatttgtgatcaactacgactaattggtagattttgtcagcaaaaaacagtgttagatcttctattg 117  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| | ||||||||||||||    
T  9025727 tgaccagcttttgcatgttctactcaatctgtcaatttgtgatcaactacgactaattggtacattttgtcagcaaaaaacagcggtagatcttctattg 9025628  T
Q  118 aataattgaaattgtaatgccttttgtatgaccaaaaatg---tgaatactaatatttcaatacttcatgttcttgg 191  Q
    ||||||||||||| ||||||||||||||||||||||||||   ||||||||||||||| ||||||||||| ||||||    
T  9025627 aataattgaaattataatgccttttgtatgaccaaaaatgtgatgaatactaatattttaatacttcatgctcttgg 9025551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University