View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11930_low_98 (Length: 281)

Name: NF11930_low_98
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11930_low_98
NF11930_low_98
[»] chr5 (4 HSPs)
chr5 (18-275)||(37232768-37233025)
chr5 (38-112)||(37385086-37385160)
chr5 (38-108)||(37218119-37218189)
chr5 (38-108)||(37223833-37223903)


Alignment Details
Target: chr5 (Bit Score: 258; Significance: 1e-144; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 18 - 275
Target Start/End: Original strand, 37232768 - 37233025
Alignment:
Q  18 taaccaagctgactaatatcgcaaattcaacagataacactaatcacatggcaggcacatttggttacatgccgcccgagtatgatgaattctgcccttt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37232768 taaccaagctgactaatatcgcaaattcaacagataacactaatcacatggcaggcacatttggttacatgccgcccgagtatgatgaattctgcccttt 37232867  T
Q  118 ctttttatgtggttgattgctatcatatctaatttgcagttttgaaatcaaagatccgttccttagtttctttcgaaggatatagcatctttccccgttt 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37232868 ctttttatgtggttgattgctatcatatctaatttgcagttttgaaatcaaagatccgttccttagtttctttcgaaggatatagcatctttccccgttt 37232967  T
Q  218 gcgtttaaagaatattaccatgataaatccaccttattcttactactaatcaattatt 275  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37232968 gcgtttaaagaatattaccatgataaatccaccttattcttactactaatcaattatt 37233025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 38 - 112
Target Start/End: Complemental strand, 37385160 - 37385086
Alignment:
Q  38 gcaaattcaacagataacactaatcacatggcaggcacatttggttacatgccgcccgagtatgatgaattctgc 112  Q
    |||||||||||||||||||||  |||  |||| |||||||||||||||||||| || ||||||||||||||||||    
T  37385160 gcaaattcaacagataacactcttcatgtggctggcacatttggttacatgccacctgagtatgatgaattctgc 37385086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 38 - 108
Target Start/End: Original strand, 37218119 - 37218189
Alignment:
Q  38 gcaaattcaacagataacactaatcacatggcaggcacatttggttacatgccgcccgagtatgatgaatt 108  Q
    ||||||||| |||||||||||  |||  ||||||||||||||||||||||||| || ||||||||||||||    
T  37218119 gcaaattcagcagataacactgttcatgtggcaggcacatttggttacatgccacctgagtatgatgaatt 37218189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 38 - 108
Target Start/End: Original strand, 37223833 - 37223903
Alignment:
Q  38 gcaaattcaacagataacactaatcacatggcaggcacatttggttacatgccgcccgagtatgatgaatt 108  Q
    |||| |||| ||||||||||| ||||  ||||||||||||||||||||||||| || ||||||||||||||    
T  37223833 gcaagttcagcagataacactgatcatgtggcaggcacatttggttacatgccacctgagtatgatgaatt 37223903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University