View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11930_low_152 (Length: 203)

Name: NF11930_low_152
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11930_low_152
NF11930_low_152
[»] chr7 (1 HSPs)
chr7 (4-87)||(25872417-25872505)


Alignment Details
Target: chr7 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 4 - 87
Target Start/End: Complemental strand, 25872505 - 25872417
Alignment:
Q  4 gtgatgcggaatttgacaaatc--gatttttctat---acgcagtttagtacaaaatggtatcaaacaacaacgctacaagctataaca 87  Q
    ||||||||||||||||||||||  |||||||||||   |||| ||||||||||||||||| ||||||||||||||||||||||||||||    
T  25872505 gtgatgcggaatttgacaaatcacgatttttctatgatacgctgtttagtacaaaatggtttcaaacaacaacgctacaagctataaca 25872417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University