View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11928_low_113 (Length: 228)

Name: NF11928_low_113
Description: NF11928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11928_low_113
NF11928_low_113
[»] chr2 (1 HSPs)
chr2 (17-212)||(37713602-37713796)
[»] chr4 (1 HSPs)
chr4 (14-57)||(36366670-36366713)


Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 17 - 212
Target Start/End: Original strand, 37713602 - 37713796
Alignment:
Q  17 aagaatccatccaaagcatactctggagacatatatccactacnnnnnnnttgttacatgtagcattttagcaagcatgtaaaaacatcttggcctggta 116  Q
    |||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||| ||     
T  37713602 aagaatccatccaaagcatactctggagacatatatccactacaaaaaa-ttgttacatgtagcattttagcaagcatgtaaaaacatcttggcctagtg 37713700  T
Q  117 aatatttgaataaataaacaaaacttgggaattgtgaattaaacttttaaaataacatttgcataaagaacttactaggttcccattactctttgg 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  37713701 aatatttgaataaataaacaaaacttgggaattgtgaattaaacttttaaaataacatttgtataaagaacttactaggttcccattactctttgg 37713796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 14 - 57
Target Start/End: Complemental strand, 36366713 - 36366670
Alignment:
Q  14 gagaagaatccatccaaagcatactctggagacatatatccact 57  Q
    ||||||| |||||||| ||||||||||||||||||||| |||||    
T  36366713 gagaagattccatccatagcatactctggagacatatagccact 36366670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University