View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11923_low_20 (Length: 270)

Name: NF11923_low_20
Description: NF11923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11923_low_20
NF11923_low_20
[»] chr3 (1 HSPs)
chr3 (1-253)||(49298231-49298473)


Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 49298473 - 49298231
Alignment:
Q  1 tgagctatggtatagtgatggagatatagatgtgatcatatctttctgtttagaaacttttttgttaccgatatcattgtatatgtnnnnnnnnnnnnnn 100  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| |||||||||||||                   
T  49298473 tgagctatggtatagtgatggagatatagatgttatcatatctttctgtttagaaacttttttgttatcga-atcattgtatatggaggggggcacc--- 49298378  T
Q  101 nntgtcgtcaatatttgaacgagtgtaaactctaatgactattttgaccctgtgaataatgttattgaaatgactctcttaaccgcgtgaggatcatgat 200  Q
       ||||||||||||||||||||||||||||||||||||||||||||||||||||||   || |||||||||||||||||||||||||||||||||||||    
T  49298377 ---gtcgtcaatatttgaacgagtgtaaactctaatgactattttgaccctgtgaat---gtaattgaaatgactctcttaaccgcgtgaggatcatgat 49298284  T
Q  201 caaaaacgaaaaaggtattaacttgatttcccgcccaaaacagggaagttttg 253  Q
    | |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  49298283 cgaaaacgaaaaaggtattaacttgatttcccgcccaaaacagggaagttttg 49298231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University