View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11923_low_18 (Length: 300)

Name: NF11923_low_18
Description: NF11923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11923_low_18
NF11923_low_18
[»] chr6 (1 HSPs)
chr6 (9-285)||(15557591-15557867)
[»] chr8 (1 HSPs)
chr8 (116-259)||(24026353-24026496)
[»] chr5 (1 HSPs)
chr5 (116-156)||(24056299-24056339)
[»] chr4 (1 HSPs)
chr4 (123-211)||(22392562-22392650)


Alignment Details
Target: chr6 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 9 - 285
Target Start/End: Complemental strand, 15557867 - 15557591
Alignment:
Q  9 aatgagggactatgcttgtagcctgctgcagtgtgggaaccataatatccttgtccaacaacaccctcttgggaatagaaacatcctgctggccaatgtc 108  Q
    |||||||||||||||||||||||||||||  |||||||||| ||||||||||||||||||| ||||||||||||||||||||||| ||||| | ||||||    
T  15557867 aatgagggactatgcttgtagcctgctgctctgtgggaaccgtaatatccttgtccaacaataccctcttgggaatagaaacatcttgctgactaatgtc 15557768  T
Q  109 cacagaggcaaatgcctttgaagatccaatgccctctggattatccttagacttccacgtttgttttgatctttgcgaatgaaccggttgcttcccgtta 208  Q
    |||||||||||| |||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||    
T  15557767 cacagaggcaaaggcctttgaagatccaatgccctccagattatccttagacttccacgtttgttttgatctttatgaatgaaccggttgcttcccgtta 15557668  T
Q  209 tcaatagttttctttccaacgtctgtagggtgctcatgtgtttccgctctttgagggcgtaggcgacggcattaatt 285  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |||| ||||    
T  15557667 tcaatagttttctttccaacgtctgtatggtgctcatgtgtttccgctctttgagggtgtaggcgacagcatgaatt 15557591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 64; Significance: 5e-28; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 116 - 259
Target Start/End: Complemental strand, 24026496 - 24026353
Alignment:
Q  116 gcaaatgcctttgaagatccaatgccctctggattatccttagacttccacgtttgttttgatctttgcgaatgaaccggttgcttcccgttatcaatag 215  Q
    ||||| |||||||| || | ||||||||| ||||||||||| |  ||||| | |||||||| |  ||||||||||||||||||||| ||||||||||| |    
T  24026496 gcaaacgcctttgaggacctaatgccctccggattatccttcggtttccaggcttgttttggttgttgcgaatgaaccggttgcttaccgttatcaattg 24026397  T
Q  216 ttttctttccaacgtctgtagggtgctcatgtgtttccgctctt 259  Q
    ||||||||||||||| ||| || | ||||||||||||| |||||    
T  24026396 ttttctttccaacgtttgttggctactcatgtgtttccactctt 24026353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 116 - 156
Target Start/End: Complemental strand, 24056339 - 24056299
Alignment:
Q  116 gcaaatgcctttgaagatccaatgccctctggattatcctt 156  Q
    ||||| |||||||| ||||||||||||||||||||||||||    
T  24056339 gcaaacgcctttgatgatccaatgccctctggattatcctt 24056299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 123 - 211
Target Start/End: Original strand, 22392562 - 22392650
Alignment:
Q  123 cctttgaagatccaatgccctctggattatccttagacttccacgtttgttttgatctttgcgaatgaaccggttgcttcccgttatca 211  Q
    ||||||| || ||||| ||||| || |||||||| | |||||| |||||||||||| |||| ||||| || || ||||| || ||||||    
T  22392562 cctttgaggagccaattccctccgggttatccttcggcttccaagtttgttttgatttttgtgaatggactggctgctttcctttatca 22392650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University