View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11921_low_34 (Length: 226)

Name: NF11921_low_34
Description: NF11921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11921_low_34
NF11921_low_34
[»] chr7 (1 HSPs)
chr7 (30-212)||(22915560-22915743)


Alignment Details
Target: chr7 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 30 - 212
Target Start/End: Complemental strand, 22915743 - 22915560
Alignment:
Q  30 atttaaaatcaatttt-gtcgctacaaaaacaaatactcactacatctttgtaaattaaatttgaaaatcaaaagaagaaatgaaccaagggtgaacctt 128  Q
    |||||||||||||||| || |||  | ||||||||||| ||||||||||||  | |||| ||||||| ||||||||| |||||||| |||||||||||||    
T  22915743 atttaaaatcaatttttgtagctttagaaacaaatacttactacatctttgctacttaattttgaaattcaaaagaaaaaatgaactaagggtgaacctt 22915644  T
Q  129 atttaaccagcctaactctatattgtttaggcaaatatagccaagcaaaaccacacaaacgagggatccaactttattcatctc 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||    
T  22915643 atttaaccagcctaactctatattgtttaggcaaatatagccaagcaaaaccacacaaaagagggatccaactttattcgtctc 22915560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University