View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11921_low_32 (Length: 233)

Name: NF11921_low_32
Description: NF11921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11921_low_32
NF11921_low_32
[»] chr2 (1 HSPs)
chr2 (10-211)||(13161981-13162190)
[»] chr3 (1 HSPs)
chr3 (194-233)||(3810923-3810962)


Alignment Details
Target: chr2 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 10 - 211
Target Start/End: Original strand, 13161981 - 13162190
Alignment:
Q  10 atgagttagagaaatcatttagcgagaaagacgtaaagtaattaagcagttttggattgtgat---------aggcccgggccatatgggattaactatg 100  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||         || ||| |  || ||||| |||||| |     
T  13161981 atgagttagagaaatcatttagcgagaaagatgtaaagtaattaagcagttttgaattgtgatcgttttaagagtcccagaacacatggggttaactttt 13162080  T
Q  101 gttttataaaggatttatggattgacatcaaaggtaattttatgaaatttttgctggaattttacttgtctggtaggctagtgaaaggatctaattgttt 200  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||    
T  13162081 gttttataa-ggatttatggattgacatcaaaggtaattttatgaaatttttgctggaattttacttgtatggtaggctggtgaaaggatctaattgttt 13162179  T
Q  201 atttatttatt 211  Q
    |||||||||||    
T  13162180 atttatttatt 13162190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 194 - 233
Target Start/End: Complemental strand, 3810962 - 3810923
Alignment:
Q  194 attgtttatttatttattgtttattttgaatgtttgagtt 233  Q
    |||||||| |||||| ||||||||||||||||||||||||    
T  3810962 attgtttaattatttgttgtttattttgaatgtttgagtt 3810923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University