View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11903_low_23 (Length: 209)

Name: NF11903_low_23
Description: NF11903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11903_low_23
NF11903_low_23
[»] chr7 (1 HSPs)
chr7 (18-194)||(44542459-44542635)


Alignment Details
Target: chr7 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 18 - 194
Target Start/End: Complemental strand, 44542635 - 44542459
Alignment:
Q  18 aacctttacgccgtgattgcggttgcagacagcgatttaaaacattcttttattaataattatgtccttccttttgtcatgttcaattacataaaatttc 117  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44542635 aacctttatgccgtgattgcggttgcagacagcgatttaaaacattcttttattaataattatgtccttccttttgtcatgttcaattacataaaatttc 44542536  T
Q  118 attacatcgttaacttgtgtcaattgttgcagttgtttgacatccaatgagtgcaccaagacaattagttcctttga 194  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44542535 attacatcgttaacttgtgtcaattgttgcagttgtttgacatccaatgagtgcaccaagacaattagttcctttga 44542459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University