View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11892_low_39 (Length: 224)

Name: NF11892_low_39
Description: NF11892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11892_low_39
NF11892_low_39
[»] chr8 (1 HSPs)
chr8 (19-207)||(9988446-9988631)


Alignment Details
Target: chr8 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 19 - 207
Target Start/End: Original strand, 9988446 - 9988631
Alignment:
Q  19 aaaggggcattgcaaacaatatttgtaacattaatatttggctagcaccctgaannnnnnnggtatatatgtaacctatgaattgaagtagtagtagtag 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||       | ||||||||||||||||||||||||||||||||||       
T  9988446 aaaggggcattgcaaacaatatttgtaacattaatatttggctagcaccctgaatttttttgctatatatgtaacctatgaattgaagtagtagtag--- 9988542  T
Q  119 ctaacaactnnnnnnngtgcttgcaataataaggagcaaaatagcatgttgaaaagtcttctttgtgatgattattatccattttgcat 207  Q
    |||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9988543 ctaacaactaaaaaaagtgcttgcaataataaggagcaaaatagcatgttgaaaagtcttctttgtgatgattattatccattttgcat 9988631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University