View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11890_high_1 (Length: 1032)

Name: NF11890_high_1
Description: NF11890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11890_high_1
NF11890_high_1
[»] chr8 (2 HSPs)
chr8 (448-568)||(24942002-24942119)
chr8 (250-283)||(20515595-20515628)
[»] chr4 (1 HSPs)
chr4 (318-392)||(11299382-11299456)
[»] chr2 (1 HSPs)
chr2 (279-382)||(35189933-35190036)


Alignment Details
Target: chr8 (Bit Score: 95; Significance: 6e-46; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 95; E-Value: 6e-46
Query Start/End: Original strand, 448 - 568
Target Start/End: Complemental strand, 24942119 - 24942002
Alignment:
Q  448 gcaacatgtaactaatagaacaacatatgtcaatatgctcatatgcgtttttgaagtaactttcctctaaaactcacatagtgactcatccaagtctcta 547  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||    
T  24942119 gcaacatgtaactaatagaacaacatatatcaatatgctcatatgcgttttggaagtaactttcctctaaaactcacatagtgacacatccaagtctcta 24942020  T
Q  548 tacgtactcaaacaaacacct 568  Q
    |||   |||||||||||||||    
T  24942019 tac---ctcaaacaaacacct 24942002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 250 - 283
Target Start/End: Original strand, 20515595 - 20515628
Alignment:
Q  250 agaagttgaatgattgaagatgcttccagagatg 283  Q
    ||||||||||||||||||||||||||||||||||    
T  20515595 agaagttgaatgattgaagatgcttccagagatg 20515628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.0000000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 318 - 392
Target Start/End: Original strand, 11299382 - 11299456
Alignment:
Q  318 atggaggttttggttgagaggaatgaaaggatgtggcagagtatagagtctggtaaggtgcttattctgtcaatg 392  Q
    |||| ||||||||||| |||||| || | |||||||||||||| |||||||||||   |||||| ||||||||||    
T  11299382 atggtggttttggttgggaggaaggagaagatgtggcagagtacagagtctggtagattgcttagtctgtcaatg 11299456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 32; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 279 - 382
Target Start/End: Original strand, 35189933 - 35190036
Alignment:
Q  279 agatggcgccagcggcgagaaacgagagagattgttgatatggaggttttggttgagaggaatgaaaggatgtggcagagtatagagtctggtaaggtgc 378  Q
    ||||||||||| |||||||| ||||||| ||||||||  | || | ||||||||| |||||| || || || |||||||| |  |||||||||| ||||     
T  35189933 agatggcgccaacggcgagagacgagagggattgttgtgacggtgattttggttgggaggaaggagagtatatggcagaggagtgagtctggtagggtgt 35190032  T
Q  379 ttat 382  Q
    ||||    
T  35190033 ttat 35190036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University