View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11887_low_32 (Length: 209)

Name: NF11887_low_32
Description: NF11887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11887_low_32
NF11887_low_32
[»] chr3 (1 HSPs)
chr3 (35-197)||(49134071-49134231)


Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 35 - 197
Target Start/End: Original strand, 49134071 - 49134231
Alignment:
Q  35 atgaatatcacggggttgaaagtgattgaagggaaggggtgaggttgtcttaaatatgaaggaagttactactagattacaatccccttaacattagggg 134  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  49134071 atgaatatcacggggttgaaagtgattgaagggaaggggtgaggttgtcttaaatatgaaggaagttactactagattacaatccccttaacattagggg 49134170  T
Q  135 attttgttgggttgggtgcgcaaaaggaagagaagagagacaaagaatctacggcctttgctt 197  Q
    |||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||    
T  49134171 attttgttgggttgggtgcgcaaaaggaagaga--agagacaaagaatctacggcctttgctt 49134231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University