View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11885_low_54 (Length: 230)

Name: NF11885_low_54
Description: NF11885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11885_low_54
NF11885_low_54
[»] chr5 (1 HSPs)
chr5 (6-228)||(33134663-33134885)


Alignment Details
Target: chr5 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 6 - 228
Target Start/End: Original strand, 33134663 - 33134885
Alignment:
Q  6 aggttcaaaccttaaaaagtagaaactaacataactcaataaaatttatgtatatatnnnnnnnnnttgnnnnnnnnnnnngaggggaagttgataatct 105  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||         | |            |||||||||||||||||||    
T  33134663 aggttcaaaccttaaaaactagaaactaacataactcaataaaatttatgtatatataaaaaaaaat-gtttttgtttattgaggggaagttgataatct 33134761  T
Q  106 tacatatatacaaagaattgatcacaaaataatatgtatatatagttgaaattttatcaggaggataaatttgatttagatgaaggaatca-tgacacaa 204  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||    
T  33134762 tacctatatacaaagaattgatcacaaaataatatgtatatatagttgaaattttatcaggaggataaatttgatttagatgaaggaatcattgacataa 33134861  T
Q  205 aattaactttcaaacaaacttttt 228  Q
    ||| ||||||||||||||||||||    
T  33134862 aatcaactttcaaacaaacttttt 33134885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University