View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11867_low_38 (Length: 247)

Name: NF11867_low_38
Description: NF11867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11867_low_38
NF11867_low_38
[»] chr2 (1 HSPs)
chr2 (104-240)||(6585946-6586082)


Alignment Details
Target: chr2 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 104 - 240
Target Start/End: Complemental strand, 6586082 - 6585946
Alignment:
Q  104 ttttactatgtttttaatgagaaatcatgtagaactataacagcaaatcattagtagtccacttgtctgcttaccatagtgcgaggtatagtgaaaattc 203  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6586082 ttttacaatgtttttaatgagaaatcatgtagaactataacagcaaatcattagtagtccacttgtctgcttaccatagtgcgaggtatagtgaaaattc 6585983  T
Q  204 gaactcagaccacttcaattggccagcctctcctatg 240  Q
    ||| |||||||||||||||||||||||||||||||||    
T  6585982 gaaatcagaccacttcaattggccagcctctcctatg 6585946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University