View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11866_low_27 (Length: 212)

Name: NF11866_low_27
Description: NF11866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11866_low_27
NF11866_low_27
[»] chr8 (1 HSPs)
chr8 (18-195)||(43383720-43383906)


Alignment Details
Target: chr8 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 18 - 195
Target Start/End: Original strand, 43383720 - 43383906
Alignment:
Q  18 agatccatccaaatccttgaccgactaaagttcctgtgaaatcgctgtgacactttgtggcagaatcgctttccttttctctgtgagataaccatgaaga 117  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  43383720 agatccatccaaatccttgaccgactaaagttactgtgaaatcgctgtggcactttgcggcagaatcgctttccttttctctgtgagataaccatgaaga 43383819  T
Q  118 agagaagatatttagaatc---------ttattgctgctattaaaccgaactgacaccgattcagtttttgatgttttaatcgttct 195  Q
    |||||||||||||||||||          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43383820 agagaagatatttagaatcgaccgtttgatattgctgctattaaaccgaactgacaccgattcagtttttgatgttttaatcgttct 43383906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University