View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11862_high_10 (Length: 245)

Name: NF11862_high_10
Description: NF11862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11862_high_10
NF11862_high_10
[»] chr4 (1 HSPs)
chr4 (2-229)||(38503653-38503880)


Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 2 - 229
Target Start/End: Original strand, 38503653 - 38503880
Alignment:
Q  2 ataagtatcaaaaatttagtctctcaaactagctgaaattgtcttcgaaattgaaaaactttgatcatattattactcttggatccataagtttggttcg 101  Q
    ||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
T  38503653 ataagtatcgaaaatttagtctctcaaactagctgaatttgtcttcgaaattgaaaaactttgatcatattattactcttggatccataagtttggtttg 38503752  T
Q  102 ggaaattgctgtggatgaactacttcaatctgac-ttttttggttttagataacattttgaaattttattaatttgagagatcaaattacgcgtctccta 200  Q
    |||||||||||||||||||||||||||||| |||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  38503753 ggaaattgctgtggatgaactacttcaatc-gacggtttttggttttagataacattttgaaattttattaatttgagagatcaaattacgcgtcaccta 38503851  T
Q  201 caatctcaggggctaaaatgaagatctac 229  Q
    |||||||||||||||||||||||||||||    
T  38503852 caatctcaggggctaaaatgaagatctac 38503880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University