View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11858_high_21 (Length: 215)

Name: NF11858_high_21
Description: NF11858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11858_high_21
NF11858_high_21
[»] chr4 (1 HSPs)
chr4 (71-201)||(48598146-48598276)


Alignment Details
Target: chr4 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 71 - 201
Target Start/End: Original strand, 48598146 - 48598276
Alignment:
Q  71 tgaacacaatgtagatatagtactgagcaaagatttataagaacaaaccttcttaagcaatgattagtgccatgtattgtatcaataaaaagattttaat 170  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48598146 tgaacacgatgtagatatagtactgagcaaagatttataagaacaaaccttcttaagcaatgattagtgccatgtattgtatcaataaaaagattttaat 48598245  T
Q  171 ataggatataaaggttggcttggtggttggt 201  Q
    |||||||||||||||||||||||||||||||    
T  48598246 ataggatataaaggttggcttggtggttggt 48598276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University