View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11856_low_81 (Length: 239)

Name: NF11856_low_81
Description: NF11856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11856_low_81
NF11856_low_81
[»] chr4 (1 HSPs)
chr4 (44-225)||(51364990-51365171)


Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 44 - 225
Target Start/End: Complemental strand, 51365171 - 51364990
Alignment:
Q  44 aaatcaacgaaagttgtaccataggctcgtaaatcaaactcttatgtttgtctcaggtatatccgttttcggtttgacttgttggttgttcataaagttt 143  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  51365171 aaatcaacgaaagttgtaccataggcttgtaaatcaaactcttatgtttgtctcaggtatatccgttttcggtttgacttgttggttgttcataaagttt 51365072  T
Q  144 cttttggctttatttgatttttgtatatcttggttcatgtgttctacttatttggttgcatatttcattttgatattccatg 225  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  51365071 cttttggctttatttgatttttgtatatcttggttcatgtgttctacttatttggttgcatatttcattttgatattccatg 51364990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University