View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11854_high_90 (Length: 245)

Name: NF11854_high_90
Description: NF11854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11854_high_90
NF11854_high_90
[»] scaffold0003 (2 HSPs)
scaffold0003 (120-226)||(41944-42050)
scaffold0003 (120-226)||(35274-35380)
[»] chr6 (1 HSPs)
chr6 (120-226)||(27445308-27445414)
[»] chr4 (1 HSPs)
chr4 (6-121)||(37618447-37618559)


Alignment Details
Target: scaffold0003 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 120 - 226
Target Start/End: Original strand, 41944 - 42050
Alignment:
Q  120 aattagcagaattcttattgcgcataggagcgaaaatgatattttggaatcctcaaacaaaaattgcagatttaacaataaagaaagaaggaaataatcc 219  Q
    |||||||||||||||||||| |||||||||| || ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||     
T  41944 aattagcagaattcttattgtgcataggagcaaacatgatattttggaatcctcaaacaaaaattgcagatttaaccataaagaatgaaggaaataatcg 42043  T
Q  220 atcatag 226  Q
    |||||||    
T  42044 atcatag 42050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 120 - 226
Target Start/End: Original strand, 35274 - 35380
Alignment:
Q  120 aattagcagaattcttattgcgcataggagcgaaaatgatattttggaatcctcaaacaaaaattgcagatttaacaataaagaaagaaggaaataatcc 219  Q
    |||||||||||||||||||| |||||||||| || |||||||||||||||||||||||| |||||||||||||||| |||||||| |||||||||||||     
T  35274 aattagcagaattcttattgtgcataggagcaaacatgatattttggaatcctcaaacagaaattgcagatttaaccataaagaatgaaggaaataatcg 35373  T
Q  220 atcatag 226  Q
    |||||||    
T  35374 atcatag 35380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 120 - 226
Target Start/End: Complemental strand, 27445414 - 27445308
Alignment:
Q  120 aattagcagaattcttattgcgcataggagcgaaaatgatattttggaatcctcaaacaaaaattgcagatttaacaataaagaaagaaggaaataatcc 219  Q
    |||||||||||||||||||| |||||||||| || ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||     
T  27445414 aattagcagaattcttattgtgcataggagcaaacatgatattttggaatcctcaaacaaaaattgcagatttaaccataaagaatgaaggaaataatcg 27445315  T
Q  220 atcatag 226  Q
    |||||||    
T  27445314 atcatag 27445308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 6 - 121
Target Start/End: Original strand, 37618447 - 37618559
Alignment:
Q  6 agcagcacagaccaaaacacacatagcccaaataatccttaaccaaatacagatgtgcacagaggaggaatctgattacagcgatgaaccactacgaatc 105  Q
    |||| |||| || |||||||||||||||||||||||||||||||||| ||||||||||||    |||||| ||||||||||||||| |||||||||||||    
T  37618447 agcaacacacacaaaaacacacatagcccaaataatccttaaccaaacacagatgtgcac---cgaggaacctgattacagcgatgtaccactacgaatc 37618543  T
Q  106 cagagaacctggtgaa 121  Q
    ||||||||||||||||    
T  37618544 cagagaacctggtgaa 37618559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University