View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11854_high_84 (Length: 250)

Name: NF11854_high_84
Description: NF11854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11854_high_84
NF11854_high_84
[»] chr8 (2 HSPs)
chr8 (1-70)||(40543962-40544031)
chr8 (200-234)||(40543798-40543832)


Alignment Details
Target: chr8 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 40544031 - 40543962
Alignment:
Q  1 gtagagtgcagctttaccattgacatcttggaagcacaagttacccaaaagggacattgtaaaggcactt 70  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||    
T  40544031 gtagagtgcagctttaccattgacatcttggaagcacaaattacccaaaagggatattgtaaaggcactt 40543962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 200 - 234
Target Start/End: Complemental strand, 40543832 - 40543798
Alignment:
Q  200 tagttaaccaactttgaaacattcacccttgaggg 234  Q
    ||||||||||| |||||||||||||||||||||||    
T  40543832 tagttaaccaaatttgaaacattcacccttgaggg 40543798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University