View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11853_low_57 (Length: 210)

Name: NF11853_low_57
Description: NF11853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11853_low_57
NF11853_low_57
[»] chr6 (1 HSPs)
chr6 (50-192)||(14501398-14501540)


Alignment Details
Target: chr6 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 50 - 192
Target Start/End: Original strand, 14501398 - 14501540
Alignment:
Q  50 accatagatgacatgagctcatgaacattactttgttatatgtgaaatttagggaatcagcaggatgtggtcatcaatcaaatatgcctagcttcatgaa 149  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14501398 accatagatgacatgagctcatgaccattactttgttatatgtgaaatttagggaatcagcaggatgtggtcatcaatcaaatatgcctagcttcatgaa 14501497  T
Q  150 tactagccacataaatttcttgtattcttgttatttatttatg 192  Q
    |||||||||||||||||||||||||||||||||||||||||||    
T  14501498 tactagccacataaatttcttgtattcttgttatttatttatg 14501540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University