View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11853_low_47 (Length: 240)

Name: NF11853_low_47
Description: NF11853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11853_low_47
NF11853_low_47
[»] chr4 (1 HSPs)
chr4 (89-226)||(38039059-38039196)


Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 89 - 226
Target Start/End: Original strand, 38039059 - 38039196
Alignment:
Q  89 tcccaacactagaagaaatgttaagaccaaacttggcaaaacaatcaacaactttatttactttccaatgcacatgaataacagaccaagaagacaactg 188  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  38039059 tcccagcactagaagaaatgttaagaccaaacttggcaaaacaatcaacaactttattaactttccaatgcacatgaataacagaccaagaagacaactg 38039158  T
Q  189 ctcgaggagatccctaatctggataaaatggctggtgt 226  Q
    |||||||||||||||||||||||||| |||||||||||    
T  38039159 ctcgaggagatccctaatctggataacatggctggtgt 38039196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University