View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11850_low_11 (Length: 413)

Name: NF11850_low_11
Description: NF11850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11850_low_11
NF11850_low_11
[»] chr1 (2 HSPs)
chr1 (203-394)||(31303874-31304059)
chr1 (1-137)||(31304125-31304261)


Alignment Details
Target: chr1 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 203 - 394
Target Start/End: Complemental strand, 31304059 - 31303874
Alignment:
Q  203 aatgggaaggttttggtgaagaagagagtgtttcgggtaagtaagggagaagaacaagagagggaaagtgaagtagccattgcagcttgcttcattggta 302  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
T  31304059 aatgagaaggttttggtgaagaagagagtgtttcgggtaagtaagggagaagaacaagagagggaaagtgaagtagccattgcagcttgcttcattggtt 31303960  T
Q  303 tttctctctctgctcctccaagtgcttagttaacactaacacgttaataatacgaatatatgtgagtgcgaaggataatacaagttggtctt 394  Q
    | ||||||||||||||||||||||||||||||      ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31303959 tctctctctctgctcctccaagtgcttagtta------acacgttaataatacgaatatatgtgagtgcgaaggataatacaagttggtctt 31303874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 31304261 - 31304125
Alignment:
Q  1 gttagcaccaaaattggcagcgaagcgagaagcacggacacctccgcttccggcaccgatggtgaagaggtcgaaatcatagtggcgggtggggtcggct 100  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |||||||| |||||||||| |||||||||| |     
T  31304261 gttagcaccaaaattggcagcgaagcgagaagcacggacaccgccgcttccggcaccgatggtaaaaaggtcgaagtcatagtggccggtggggtcgacg 31304162  T
Q  101 ccgttttgggattcagcgcgaacggcgaaggtgcggc 137  Q
    |||||||| || |||||||| || || ||||||||||    
T  31304161 ccgttttgcgactcagcgcggaccgcaaaggtgcggc 31304125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University