View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11847_low_21 (Length: 236)

Name: NF11847_low_21
Description: NF11847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11847_low_21
NF11847_low_21
[»] chr4 (1 HSPs)
chr4 (15-217)||(35684868-35685070)
[»] chr2 (1 HSPs)
chr2 (15-141)||(40672148-40672274)


Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 15 - 217
Target Start/End: Original strand, 35684868 - 35685070
Alignment:
Q  15 aggttttgcagtttaccttggcagatgtgagtcaggctatatgtgtttctcatacaagtaaggagaacacggttttgaggtcgggtttggcgccggagaa 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35684868 aggttttgcagtttaccttggcagatgtgagtcaggctatatgtgtttctcatacaagtaaggagaacacggttttgaggtcgggtttggcgccggagaa 35684967  T
Q  115 ggtttttgtaatacctaatgctgttgacactgccaagtttaagccaatgtcggaggaggagcgccgtagttctaaacctagtagatccgaaattgttatt 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35684968 ggtttttgtaatacctaatgctgttgacactgccaagtttaagccaatgtcggaggaggagcgccgtagttctaaacctagtagatccgaaattgttatt 35685067  T
Q  215 gtt 217  Q
    |||    
T  35685068 gtt 35685070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 15 - 141
Target Start/End: Complemental strand, 40672274 - 40672148
Alignment:
Q  15 aggttttgcagtttaccttggcagatgtgagtcaggctatatgtgtttctcatacaagtaaggagaacacggttttgaggtcgggtttggcgccggagaa 114  Q
    |||| ||||||||||||||||||||||||| ||| || |||||||||||||| ||||| ||||| ||||| || ||  |||| |||||| | || || ||    
T  40672274 aggtgttgcagtttaccttggcagatgtgactcaagccatatgtgtttctcacacaagcaaggaaaacacagtgttacggtcaggtttgccaccagataa 40672175  T
Q  115 ggtttttgtaatacctaatgctgttga 141  Q
     |||||||||||||||||||| |||||    
T  40672174 agtttttgtaatacctaatgccgttga 40672148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University