View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11840_high_18 (Length: 209)

Name: NF11840_high_18
Description: NF11840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11840_high_18
NF11840_high_18
[»] chr3 (1 HSPs)
chr3 (83-193)||(2571498-2571608)


Alignment Details
Target: chr3 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 83 - 193
Target Start/End: Complemental strand, 2571608 - 2571498
Alignment:
Q  83 atgaaaaggagaagggaaagtgaaggtgacatgnnnnnnnggaagtataatgaaaggtggtttgagtatgtgttattttgcttgtgggatgtgtttagga 182  Q
    |||||||||||||||||||||||||||||||||       |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2571608 atgaaaaggagaagggaaagtgaaggtgacatgtttttttggaagtttaatgaaaggtggtttgagtatgtgttattttgcttgtgggatgtgtttagga 2571509  T
Q  183 ataatggtagt 193  Q
    |||||||||||    
T  2571508 ataatggtagt 2571498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University