View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11835_low_121 (Length: 238)

Name: NF11835_low_121
Description: NF11835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11835_low_121
NF11835_low_121
[»] scaffold0147 (1 HSPs)
scaffold0147 (1-224)||(14593-14816)


Alignment Details
Target: scaffold0147 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: scaffold0147
Description:

Target: scaffold0147; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 14593 - 14816
Alignment:
Q  1 caatgaatgaccctattggacacttgccatagtttcaatgactctcccacccacctctttcctaaattatgaagttatagcgactagtctttcaacatat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14593 caatgaatgaccctattggacacttgccatagtttcaatgactctcccacccacctctttcctaaattatgaagttatagcgactagtctttcaacatat 14692  T
Q  101 tggcattatctgttgctttcttgaaaaattgtgtccagtggaaagctactgaactttggctactgacataactttgaaagcacaaacatggattataagg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14693 tggcattatctgttgctttcttgaaaaattgtgtccagtggaaagctactgaactttggctactgacataactttgaaagcacaaacatggattataagg 14792  T
Q  201 acataacggaacagtatatcttat 224  Q
    ||||||||||||||||||||||||    
T  14793 acataacggaacagtatatcttat 14816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University