View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11835_high_11 (Length: 609)

Name: NF11835_high_11
Description: NF11835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11835_high_11
NF11835_high_11
[»] chr2 (6 HSPs)
chr2 (351-606)||(31902132-31902387)
chr2 (351-609)||(18681173-18681442)
chr2 (351-443)||(12793612-12793704)
chr2 (351-443)||(915334-915426)
chr2 (532-609)||(29044001-29044078)
chr2 (517-607)||(915159-915248)
[»] chr1 (5 HSPs)
chr1 (351-609)||(4651887-4652151)
chr1 (351-443)||(2988000-2988092)
chr1 (351-408)||(35250192-35250249)
chr1 (548-608)||(37582405-37582465)
chr1 (469-550)||(11839455-11839536)
[»] chr3 (5 HSPs)
chr3 (360-605)||(30935098-30935353)
chr3 (506-609)||(1652594-1652696)
chr3 (527-608)||(7966783-7966864)
chr3 (360-420)||(1652790-1652850)
chr3 (557-606)||(22948347-22948397)
[»] chr5 (3 HSPs)
chr5 (357-568)||(36979029-36979245)
chr5 (353-524)||(31721787-31721966)
chr5 (542-609)||(31742460-31742527)
[»] chr7 (5 HSPs)
chr7 (351-508)||(46133091-46133249)
chr7 (351-609)||(38485663-38485929)
chr7 (105-202)||(19494992-19495090)
chr7 (375-609)||(9349841-9350076)
chr7 (18-57)||(19494933-19494972)
[»] chr8 (6 HSPs)
chr8 (361-609)||(30235834-30236090)
chr8 (351-526)||(35062565-35062747)
chr8 (351-567)||(10552375-10552595)
chr8 (366-443)||(32945585-32945662)
chr8 (504-581)||(32945439-32945517)
chr8 (511-563)||(41791017-41791069)
[»] chr4 (8 HSPs)
chr4 (351-443)||(43373975-43374067)
chr4 (511-605)||(43373813-43373907)
chr4 (549-606)||(43077270-43077327)
chr4 (361-443)||(19432160-19432242)
chr4 (232-292)||(19473036-19473096)
chr4 (483-592)||(24739938-24740047)
chr4 (351-420)||(35800597-35800666)
chr4 (511-567)||(19432304-19432360)
[»] chr6 (5 HSPs)
chr6 (351-442)||(12794212-12794303)
chr6 (548-592)||(6946905-6946949)
chr6 (511-607)||(9224201-9224294)
chr6 (354-443)||(26215899-26215989)
chr6 (208-287)||(28963550-28963630)


Alignment Details
Target: chr2 (Bit Score: 137; Significance: 3e-71; HSPs: 6)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 137; E-Value: 3e-71
Query Start/End: Original strand, 351 - 606
Target Start/End: Complemental strand, 31902387 - 31902132
Alignment:
Q  351 aggttgcgtggtgggggaagctgaatgatctttagagaaggagttcttcggatgtggcttggtgttggtgttgaggacttggttctcttttaccatgtgt 450  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||  |||||||||||||||||||||||||||||||| | ||||    
T  31902387 aggttgcgtggtgggggaagctgaatgatctttagagaaggagttcttcggatgtgactcagtgttggtgttgaggacttggttctcttttacaaggtgt 31902288  T
Q  451 tcgattagtagtagcgacgagtgttttggatgttg-tctttcggtggttggttagtatagaagtcagttttaggggatgatatttatttttatgggagtt 549  Q
    ||| |||||||| |||||||||||||  ||||| | | ||||  |||||||||||||||| ||||||||||| ||| |||| |||||||| ||  |||||    
T  31902287 tcggttagtagtggcgacgagtgtttcagatgtcgttttttcactggttggttagtataggagtcagttttatgggttgatgtttattttgat-agagtt 31902189  T
Q  550 gtccttatgggtgttgatcgcaaggttgtctttgttggtgtttattttcaggtgttc 606  Q
    |||||||| ||||||||||||| ||||| ||| |||||||||  ||||| |||||||    
T  31902188 gtccttattggtgttgatcgcagggttgccttggttggtgttagttttcgggtgttc 31902132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 351 - 609
Target Start/End: Original strand, 18681173 - 18681442
Alignment:
Q  351 aggttgcgtggtgggggaagctgaatgatctttagagaaggagttcttcggatgtggcttggtgttggtgttgaggacttggttctcttttacca-tgtg 449  Q
    |||||||  ||||| | |||||||||||||||||||||||||| |||||||||||||||   |||||||| |||||||| ||||||||||||| |  |||    
T  18681173 aggttgcacggtggtgaaagctgaatgatctttagagaaggagctcttcggatgtggctcaatgttggtgatgaggactaggttctcttttacaagggtg 18681272  T
Q  450 ttc------gattagtagtagcgacgagtgttttggatgt----tgtctttcggtggttggttagtatagaagtcagttttaggggatgatatttatttt 539  Q
    |||      | | ||| || ||||||||||||||||||||    | | |||  ||||||||| ||||||| ||||||||||||||| |||| ||||||||    
T  18681273 ttcttttgaggtgagtggtggcgacgagtgttttggatgtcgtgttttttttagtggttggtaagtataggagtcagttttagggggtgatgtttatttt 18681372  T
Q  540 tatgggagttgtccttatgggtgttgatcgca-aggttgtctttgttggtgtttattttcaggtgttccgc 609  Q
       ||| ||||| ||||||||||||||| ||| ||||| |||||||| || ||| ||||| ||||||||||    
T  18681373 agagggtgttgttcttatgggtgttgattgcagaggtt-tctttgttagtatttgttttcgggtgttccgc 18681442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 351 - 443
Target Start/End: Complemental strand, 12793704 - 12793612
Alignment:
Q  351 aggttgcgtggtgggggaagctgaatgatctttagagaaggagttcttcggatgtggcttggtgttggtgttgaggacttggttctcttttac 443  Q
    |||||| | ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| | |  ||||||||||||    
T  12793704 aggttgtgcggtggtggaagctgaatgatctttagagaaggagttcttcggatgtggctcggtgttggtgatgagaagtaagttctcttttac 12793612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 351 - 443
Target Start/End: Complemental strand, 915426 - 915334
Alignment:
Q  351 aggttgcgtggtgggggaagctgaatgatctttagagaaggagttcttcggatgtggcttggtgttggtgttgaggacttggttctcttttac 443  Q
    |||||||| ||||| ||||||| |||||| || ||| |||||||||||||||||| |||  ||||||||| |||||| | |||||||| ||||    
T  915426 aggttgcgcggtggtggaagctcaatgattttaagaaaaggagttcttcggatgttgctcagtgttggtgatgaggattgggttctctattac 915334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 532 - 609
Target Start/End: Complemental strand, 29044078 - 29044001
Alignment:
Q  532 tttatttttatgggagttgtccttatgggtgttgatcgcaaggttgtctttgttggtgtttattttcaggtgttccgc 609  Q
    ||||||||  |||| | ||| ||| ||||||||||||||| || ||||||||||||| ||| ||||||||||||||||    
T  29044078 tttattttggtgggtgatgtacttttgggtgttgatcgcaggggtgtctttgttggtttttgttttcaggtgttccgc 29044001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 517 - 607
Target Start/End: Complemental strand, 915248 - 915159
Alignment:
Q  517 ttttaggggatgatatttatttttatgggagttgtccttatgggtgttgatcgcaaggttgtctttgttggtgtttattttcaggtgttcc 607  Q
    |||||||||||||| ||||||||  |  | |||||||||||||||| ||| || | || |||||||||| |||||| ||||| ||||||||    
T  915248 ttttaggggatgatgtttattttggtaagtgttgtccttatgggtggtga-cgtaggggtgtctttgttagtgtttgttttcgggtgttcc 915159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 81; Significance: 8e-38; HSPs: 5)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 81; E-Value: 8e-38
Query Start/End: Original strand, 351 - 609
Target Start/End: Original strand, 4651887 - 4652151
Alignment:
Q  351 aggttgcgtggtgggggaagctgaatgatctttagagaaggagttcttcggatgtggcttggtgttggtgttgaggacttggttctcttttacca-tgtg 449  Q
    |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||   |||||||| || ||||||||||||||||||| |  |||    
T  4651887 aggttgcgcggtggtggaagctgaatgatctttagagaaggagttcttcggatgtggctcattgttggtgatggggacttggttctcttttacaagggtg 4651986  T
Q  450 ttc------gattagtagtagcgacgagtgttttggatgttg-tctttcggtggttggttagtatagaagtcagttttaggggatgatatttatttttat 542  Q
    |||      | | ||| || | |||||||||||| ||||| | | |||| ||||||||| | ||||| |||||||| ||  ||| ||| |||| |||  |    
T  4651987 ttcttttgaggtgagttgtggtgacgagtgttttagatgtcgttttttcagtggttggtaactataggagtcagttgta--ggaggatgtttagtttgtt 4652084  T
Q  543 gggagttgtccttatgggtgttgatcgcaaggttgtctttgttggtgtttattttcaggtgttccgc 609  Q
    ||| ||||| |||||||||||||||| || |||| | ||||||||||||| ||||||||||||||||    
T  4652085 gggtgttgtacttatgggtgttgatcacagggttttttttgttggtgtttgttttcaggtgttccgc 4652151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 351 - 443
Target Start/End: Complemental strand, 2988092 - 2988000
Alignment:
Q  351 aggttgcgtggtgggggaagctgaatgatctttagagaaggagttcttcggatgtggcttggtgttggtgttgaggacttggttctcttttac 443  Q
    |||||| | ||||| |||||||||||||||||||| ||||||||||||||||||||||| |||||||||| ||||||| ||||||||||||||    
T  2988092 aggttgtgcggtggtggaagctgaatgatctttagggaaggagttcttcggatgtggctcggtgttggtgatgaggacatggttctcttttac 2988000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 351 - 408
Target Start/End: Complemental strand, 35250249 - 35250192
Alignment:
Q  351 aggttgcgtggtgggggaagctgaatgatctttagagaaggagttcttcggatgtggc 408  Q
    ||||| || ||||| ||||||||||||||||||||||||||||||||||||| |||||    
T  35250249 aggttacgcggtggtggaagctgaatgatctttagagaaggagttcttcggaggtggc 35250192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 548 - 608
Target Start/End: Original strand, 37582405 - 37582465
Alignment:
Q  548 ttgtccttatgggtgttgatcgcaaggttgtctttgttggtgtttattttcaggtgttccg 608  Q
    |||||||||||| ||||||||| |||| ||||||||||| ||||||||||| |||||||||    
T  37582405 ttgtccttatggttgttgatcgtaagggtgtctttgttgatgtttattttcgggtgttccg 37582465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 469 - 550
Target Start/End: Original strand, 11839455 - 11839536
Alignment:
Q  469 gagtgttttggatgttgtctttcggtggttggttagtatagaagtcagttttaggggatgatatttatttttatgggagttg 550  Q
    ||||||| |||||||||| |||  ||||| ||| ||| ||| | ||||||||||| |||||| |||||||| ||||| ||||    
T  11839455 gagtgttatggatgttgttttttagtggtcggtaagtttaggaatcagttttaggagatgatgtttattttgatgggtgttg 11839536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 79; Significance: 1e-36; HSPs: 5)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 360 - 605
Target Start/End: Complemental strand, 30935353 - 30935098
Alignment:
Q  360 ggtgggggaagctgaatgatctttagagaaggagttcttcggatgtggcttggtgttggtgttgaggacttggttctcttttacca-tgtgttc------ 452  Q
    ||||| ||||||||||||||||||||| |||||||||||||||||||||| |||||||||| ||||||||  |||||||||||| |  ||||||          
T  30935353 ggtggtggaagctgaatgatctttagaaaaggagttcttcggatgtggctcggtgttggtgatgaggactgagttctcttttacaagggtgttcttttga 30935254  T
Q  453 gattagtagtagcgacgagtgttttggatgttgtcttt---cggtggttggttagtatagaagtcagttttaggggatgatatttatttttatgggagtt 549  Q
    | | |||||| |||||||||||| | ||||| || |||   |||||| |||| ||||||  ||||||||||||||| |||| ||||||||  |||  |||    
T  30935253 ggtgagtagtggcgacgagtgttatagatgtcgtttttttccggtggctggtaagtataagagtcagttttagggggtgatgtttattttggtggatgtt 30935154  T
Q  550 gtccttatgggtgttgatcgcaaggttgtctttgttggtgtttattttcaggtgtt 605  Q
    |  |||| ||||||||||  || |||||||||||||||||||| ||||| ||||||    
T  30935153 gctcttaagggtgttgattacagggttgtctttgttggtgtttgttttcgggtgtt 30935098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 506 - 609
Target Start/End: Complemental strand, 1652696 - 1652594
Alignment:
Q  506 atagaagtcagttttaggggatgatatttatttttatgggagttgtccttatgggtgttgatcgcaaggttgtctttgttggtgtttattttcaggtgtt 605  Q
    |||||||||||||||||||| |||| ||||||||  |||| |||||||||||| ||||||||||||||| ||||||||| |||||||| |||| ||||||    
T  1652696 atagaagtcagttttagggggtgatgtttattttggtgggtgttgtccttatgagtgttgatcgcaagggtgtctttgtgggtgttta-tttcgggtgtt 1652598  T
Q  606 ccgc 609  Q
    ||||    
T  1652597 ccgc 1652594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 527 - 608
Target Start/End: Complemental strand, 7966864 - 7966783
Alignment:
Q  527 tgatatttatttttatgggagttgtccttatgggtgttgatcgcaaggttgtctttgttggtgtttattttcaggtgttccg 608  Q
    |||| |||||||| |||||||||||| |||||||||| |||||||| | |||||||||| |||||| ||||| |||||||||    
T  7966864 tgatgtttattttgatgggagttgtctttatgggtgtggatcgcaaaggtgtctttgtttgtgtttgttttcgggtgttccg 7966783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 360 - 420
Target Start/End: Complemental strand, 1652850 - 1652790
Alignment:
Q  360 ggtgggggaagctgaatgatctttagagaaggagttcttcggatgtggcttggtgttggtg 420  Q
    ||||| ||||| ||||||||||||||| ||||||||| ||| || ||||| ||||||||||    
T  1652850 ggtggcggaagttgaatgatctttagaaaaggagttcctcgaatttggctcggtgttggtg 1652790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 557 - 606
Target Start/End: Complemental strand, 22948397 - 22948347
Alignment:
Q  557 tgggtgttgatcgcaaggttgtctttgttggtg-tttattttcaggtgttc 606  Q
    ||||||||||||||| || |||||||||||||| ||| |||||||||||||    
T  22948397 tgggtgttgatcgcatgggtgtctttgttggtgttttgttttcaggtgttc 22948347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 78; Significance: 5e-36; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 357 - 568
Target Start/End: Original strand, 36979029 - 36979245
Alignment:
Q  357 cgtggtgggggaagctgaatgatctttagagaaggagttcttcggatgtggcttggtgttggtgttgaggacttggttctcttttaccatgtgttcgatt 456  Q
    ||||||||| |||||||||||||| ||| |||| |||||||| ||||||||||||||||||||  | |||||| |||||||||||| || ||||| | |     
T  36979029 cgtggtgggagaagctgaatgatcattaaagaatgagttctttggatgtggcttggtgttggtaataaggactaggttctctttta-caggtgttaggtg 36979127  T
Q  457 agtagtagcgacgagtgttttggatgttg-tctttcggtggttggttagtatagaagtcagttt-----taggggatgatatttatttttatgggagttg 550  Q
    |||||| ||||| |||||||||||||||| | |||| ||||||||| ||||||  |||||||||     | ||||  ||| |||||||| ||||||||||    
T  36979128 agtagtggcgaccagtgttttggatgttgttttttcagtggttggtaagtataagagtcagtttgtgtgtggggggggatgtttattttgatgggagttg 36979227  T
Q  551 tccttatgggtgttgatc 568  Q
    ||||||||| ||||||||    
T  36979228 tccttatggatgttgatc 36979245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 353 - 524
Target Start/End: Original strand, 31721787 - 31721966
Alignment:
Q  353 gttgcgtggtgggggaagctgaatgatctttagagaaggagttcttcggatgtggcttggtgttggtgttgaggacttggttctcttttacca-tgtgtt 451  Q
    |||||| ||||| ||||| ||| |||||||||||||| |||||||| |||||||||| | ||||||||  |||||||  |||||||||||| |  |||||    
T  31721787 gttgcgcggtggtggaagttgattgatctttagagaatgagttctttggatgtggctcgatgttggtgacgaggactgagttctcttttacaagggtgtt 31721886  T
Q  452 ------cgattagtagtagcgacgagtgttttggatgttg-tctttcggtggttggttagtatagaagtcagttttaggg 524  Q
           | | |||||| |||||||||||| ||||||| | | |||| ||||||||| ||||||| ||||||||||||||    
T  31721887 tttttgaggtgagtagtggcgacgagtgttatggatgtcgttttttcagtggttggtaagtataggagtcagttttaggg 31721966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 542 - 609
Target Start/End: Original strand, 31742460 - 31742527
Alignment:
Q  542 tgggagttgtccttatgggtgttgatcgcaaggttgtctttgttggtgtttattttcaggtgttccgc 609  Q
    |||| ||||||||||||||| ||||||||||||  |||||||  ||||||| ||||| ||||||||||    
T  31742460 tgggtgttgtccttatgggttttgatcgcaagggagtctttgcaggtgtttgttttcgggtgttccgc 31742527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 75; Significance: 3e-34; HSPs: 5)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 351 - 508
Target Start/End: Complemental strand, 46133249 - 46133091
Alignment:
Q  351 aggttgcgtggtgggggaagctgaatgatctttagagaaggagttcttcggatgtggcttggtgttggtgttgaggacttggttctcttttaccatgtgt 450  Q
    |||||||||||||||||||||||| ||||||||||| || |||||||| ||||||| || |||||||||| ||| |||| ||||||||||||| | ||||    
T  46133249 aggttgcgtggtgggggaagctgattgatctttagataaagagttctttggatgtgactcggtgttggtgatgatgactgggttctcttttacaaggtgt 46133150  T
Q  451 tcgattagtagtagcgacgagtgttttggatgttg-tctttcggtggttggttagtata 508  Q
    | | | |||||| || ||||||||||||||||| | | |||| ||||||||||||||||    
T  46133149 ttggtgagtagtggcaacgagtgttttggatgtcgttttttcagtggttggttagtata 46133091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 68; E-Value: 5e-30
Query Start/End: Original strand, 351 - 609
Target Start/End: Original strand, 38485663 - 38485929
Alignment:
Q  351 aggttgcgtggtgggggaagctgaatgatctttagagaaggagttcttcggatgtggcttggtgttggtgttgaggacttggttctcttttac-catgtg 449  Q
    |||||||  ||||| |||||||||||||||||||||||||||||||||| |||||||||   |||||||| | ||||||||||||||||||||  | |||    
T  38485663 aggttgcacggtggtggaagctgaatgatctttagagaaggagttcttcagatgtggctcattgttggtgataaggacttggttctcttttacaaaggtg 38485762  T
Q  450 ttc------gattagtagtagcgacgagtgttttggatg----ttgtctttcggtggttggttagtatagaagtcagttttaggggatgatatttatttt 539  Q
    |||      | | ||| || |||||||||||||||||||    || | |||| ||||||||| | ||||| |||||||||||   || ||| |||| |||    
T  38485763 ttcttttgaggtgagttgtggcgacgagtgttttggatgtcatttttttttcagtggttggtaactataggagtcagtttta---gaagatgtttagttt 38485859  T
Q  540 tatgggagttgtccttatgggtgttgatcgcaaggttgtctttgttggtgtttattttcaggtgttccgc 609  Q
      |||  ||||| |||||||||||||||||||  ||| | ||||||||||||| ||||| ||||||||||    
T  38485860 gctggatgttgtacttatgggtgttgatcgcagagttttttttgttggtgtttgttttcgggtgttccgc 38485929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 105 - 202
Target Start/End: Original strand, 19494992 - 19495090
Alignment:
Q  105 tatgtatgatgtatgattagaatctgagctataacagaatga--ttttttatgttgtcacgatcaaaacatcactatggttttaggatacatgatgtatc 202  Q
    |||||||||||||||||| ||||||||||||||||| |||||  ||||||||||||||||||||||| ||| ||||||||||| ||||  ||||||||||    
T  19494992 tatgtatgatgtatgattggaatctgagctataacaaaatgattttttttatgttgtcacgatcaaatcataactatggtttt-ggatgtatgatgtatc 19495090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 375 - 609
Target Start/End: Original strand, 9349841 - 9350076
Alignment:
Q  375 atgatctttagagaaggagttcttcggatgtggcttggtgttggtgttgaggacttggttctcttttaccatg-tgttcgatt------agtagtagcga 467  Q
    ||||| |||||||||| |||||||||||||||||| |||||||||| |||| | |  |||||||||||| | | |||||  ||      |||||| ||||    
T  9349841 atgatatttagagaagaagttcttcggatgtggctcggtgttggtgatgagtattgtgttctcttttacaagggtgttcttttggggtgagtagtggcga 9349940  T
Q  468 cgagtgttttggatgttgtctttcggtggttggttagtatagaagtcagttttaggggatgatatttatttttatgggagttgtccttatgggtgttgat 567  Q
    |||||||| ||||||| || ||   ||||||||| |||||||     |||||||||||  ||| ||||||||  |||| |||||||||||||| ||||||    
T  9349941 cgagtgttatggatgtcgttttctagtggttggtaagtatag----gagttttagggg--gatgtttattttggtgggtgttgtccttatgggggttgat 9350034  T
Q  568 cgcaaggttgtctttgttggtgtttattttcaggtgttccgc 609  Q
     ||| || |||||||||||||| || ||| ||||||||||||    
T  9350035 tgcaggggtgtctttgttggtgattttttccaggtgttccgc 9350076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 18 - 57
Target Start/End: Original strand, 19494933 - 19494972
Alignment:
Q  18 ctgcaaaggatgaaaatgaggtaaattattttttcataat 57  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  19494933 ctgcaaaggatgaaaatgaggtaaattattttttcataat 19494972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 74; Significance: 1e-33; HSPs: 6)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 361 - 609
Target Start/End: Complemental strand, 30236090 - 30235834
Alignment:
Q  361 gtgggggaagctgaatgatctttagagaaggagttcttcggatgtggcttggtgttggtgttgaggacttggttctcttttaccatg-tgttcgatt--- 456  Q
    |||| ||||||||| ||||||||||| ||| ||||||| ||||||| || ||||||||| ||||||||| | |||||| || | | | |||||| ||       
T  30236090 gtggtggaagctgattgatctttagaaaagaagttctttggatgtgactcggtgttggtattgaggactggtttctctcttgctagggtgttcgtttgtg 30235991  T
Q  457 ---agtagtagcgacgagtgttttggatgttgtct-ttcggtggttggttagtatagaagtcagttttaggggatgatatttatttttatgggagttgtc 552  Q
       |||||| |||| ||||||| ||||||| || | ||   |||| ||||| ||||| ||||||||||||||| |||| ||||||||  |||| ||||||    
T  30235990 gtgagtagtggcgatgagtgttatggatgtcgtttatttaatggtcggttaatataggagtcagttttagggggtgatgtttattttggtgggtgttgtc 30235891  T
Q  553 cttatgggtgttgatcgcaaggttgtctttgttggtgtttattttcaggtgttccgc 609  Q
    ||| |||||||||||||||||| ||||||||||||||||| ||||| | ||||||||    
T  30235890 cttttgggtgttgatcgcaagggtgtctttgttggtgtttgttttcggatgttccgc 30235834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 68; E-Value: 5e-30
Query Start/End: Original strand, 351 - 526
Target Start/End: Original strand, 35062565 - 35062747
Alignment:
Q  351 aggttgcgtggtgggggaagctgaatgatctttagagaaggagttcttcggatgtggcttggtgttggtgttgaggacttggttctcttttacca-tgtg 449  Q
    |||||||| ||||| ||||| ||||||||||||||||||||||||||||||| |||||    |||||||| |||||||| ||||||||||||| |  |||    
T  35062565 aggttgcgcggtggtggaaggtgaatgatctttagagaaggagttcttcggaggtggcacaatgttggtgatgaggactgggttctcttttacaagggtg 35062664  T
Q  450 ttc------gattagtagtagcgacgagtgttttggatgttgtctttcggtggttggttagtatagaagtcagttttagggga 526  Q
    |||      | | |||||| |||||||||||| |||||||||| |||  ||||||||||||||||  ||||||||||||||||    
T  35062665 ttctcttgaggtgagtagtggcgacgagtgttatggatgttgttttttagtggttggttagtatatgagtcagttttagggga 35062747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 351 - 567
Target Start/End: Original strand, 10552375 - 10552595
Alignment:
Q  351 aggttgcgtggtgggggaagctgaatgatctttagagaaggagttcttcggatgtggcttggtgttggtgttgaggacttggttctcttttacca-tgtg 449  Q
    ||||||||| |||| ||||||||||||||||||||||||| ||||||||||| |||||   ||||||| | |||||||| ||||||||||||| |  |||    
T  10552375 aggttgcgttgtggtggaagctgaatgatctttagagaagaagttcttcggaggtggcacagtgttggagatgaggactgggttctcttttacaagggtg 10552474  T
Q  450 ttc------gattagtagtagcgacgagtgttttggatgttgtctttcggtggttggttagtatagaagtcagttttaggggatgatatttatttttatg 543  Q
    |||      | | |||||| ||||||||| || ||||||| || |||  ||||||| ||||||||  ||||||||||||||||||   ||||||||  |     
T  10552475 ttcttttgaggtgagtagtggcgacgagttttatggatgtcgttttttagtggttgcttagtatatgagtcagttttaggggatg---tttattttggtt 10552571  T
Q  544 ggagttgtccttatgggtgttgat 567  Q
    || |||||||||| ||||||||||    
T  10552572 ggtgttgtccttaagggtgttgat 10552595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 366 - 443
Target Start/End: Complemental strand, 32945662 - 32945585
Alignment:
Q  366 ggaagctgaatgatctttagagaaggagttcttcggatgtggcttggtgttggtgttgaggacttggttctcttttac 443  Q
    ||||||||||||||||||||| ||| |||||||| |||||| || |||||||||| ||| |||| | |||| ||||||    
T  32945662 ggaagctgaatgatctttagaaaagaagttcttcagatgtgactcggtgttggtgatgatgactggtttcttttttac 32945585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 504 - 581
Target Start/End: Complemental strand, 32945517 - 32945439
Alignment:
Q  504 gtatagaagtcagttttaggggatgatatttatttttatgggagttg-tccttatgggtgttgatcgcaaggttgtctt 581  Q
    |||||| ||||||||||| ||| |||| ||||||||  |||  |||| |||||||| ||||||||||||||| ||||||    
T  32945517 gtataggagtcagttttaagggctgatgtttattttggtggatgttgatccttatgagtgttgatcgcaagggtgtctt 32945439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 511 - 563
Target Start/End: Complemental strand, 41791069 - 41791017
Alignment:
Q  511 agtcagttttaggggatgatatttatttttatgggagttgtccttatgggtgt 563  Q
    ||||||||||||||| |||| ||||||||  |||| |||||||||||| ||||    
T  41791069 agtcagttttagggggtgatgtttattttggtgggggttgtccttatgagtgt 41791017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 45; Significance: 2e-16; HSPs: 8)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 351 - 443
Target Start/End: Complemental strand, 43374067 - 43373975
Alignment:
Q  351 aggttgcgtggtgggggaagctgaatgatctttagagaaggagttcttcggatgtggcttggtgttggtgttgaggacttggttctcttttac 443  Q
    |||||||| ||||| ||||||||| ||||||||||| || ||||||||| || ||| || |||||||||| ||| |||||| |||||||||||    
T  43374067 aggttgcgcggtggtggaagctgattgatctttagaaaatgagttcttcagaggtgactcggtgttggtgatgatgacttgtttctcttttac 43373975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 511 - 605
Target Start/End: Complemental strand, 43373907 - 43373813
Alignment:
Q  511 agtcagttttaggggatgatatttatttttatgggagttgtccttatgggtgttgatcgcaaggttgtctttgttggtgtttattttcaggtgtt 605  Q
    ||||||||||||||| |||| ||||||||  |||| |||||||||||| ||||||||| || || ||||||||||||  ||| ||||| ||||||    
T  43373907 agtcagttttagggggtgatgtttattttggtgggtgttgtccttatgtgtgttgatcacatgggtgtctttgttgggttttgttttcgggtgtt 43373813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 549 - 606
Target Start/End: Original strand, 43077270 - 43077327
Alignment:
Q  549 tgtccttatgggtgttgatcgcaaggttgtctttgttggtgtttattttcaggtgttc 606  Q
    ||||||| || |||||||||||| || |||||||||||||||||||||||||||||||    
T  43077270 tgtccttttgagtgttgatcgcaggggtgtctttgttggtgtttattttcaggtgttc 43077327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 361 - 443
Target Start/End: Original strand, 19432160 - 19432242
Alignment:
Q  361 gtgggggaagctgaatgatctttagagaaggagttcttcggatgtggcttggtgttggtgttgaggacttggttctcttttac 443  Q
    |||| |||||||||||||| ||| ||  ||||||| ||||| |||| ||||||||||||| ||||||||   |||||||||||    
T  19432160 gtggtggaagctgaatgatatttggaagaggagttattcggttgtgacttggtgttggtgatgaggactgatttctcttttac 19432242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 232 - 292
Target Start/End: Original strand, 19473036 - 19473096
Alignment:
Q  232 ttggtgatattaatgtattttatagtagagagaacgatgaatgaatgattaaaatatatta 292  Q
    |||||||||||||||||||||| || ||||| || |||  |||||||||||||||| ||||    
T  19473036 ttggtgatattaatgtattttagaggagagaaaatgatacatgaatgattaaaataaatta 19473096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 483 - 592
Target Start/End: Complemental strand, 24740047 - 24739938
Alignment:
Q  483 ttgtctttcggtggttggttagtatagaagtcagttttaggggatgatatttatttttatgggagttgtccttatgggtgttgatcgcaaggttgtcttt 582  Q
    |||| |||| ||||| | ||| |||| |||||| ||||||| |  ||| ||||||||  |||| ||| |||||||| ||| ||||||||||| ||| |||    
T  24740047 ttgtttttcagtggtcgattaatatacaagtcatttttaggtggggatgtttattttagtgggtgttatccttatgagtggtgatcgcaagggtgttttt 24739948  T
Q  583 gttggtgttt 592  Q
     |||||||||    
T  24739947 attggtgttt 24739938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 420
Target Start/End: Original strand, 35800597 - 35800666
Alignment:
Q  351 aggttgcgtggtgggggaagctgaatgatctttagagaaggagttcttcggatgtggcttggtgttggtg 420  Q
    ||||| || ||||| |||| ||||||||||||| |  ||||||||||| |||||||||| | ||||||||    
T  35800597 aggtttcgcggtggtggaacctgaatgatctttggtaaaggagttctttggatgtggctcgttgttggtg 35800666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 511 - 567
Target Start/End: Original strand, 19432304 - 19432360
Alignment:
Q  511 agtcagttttaggggatgatatttatttttatgggagttgtccttatgggtgttgat 567  Q
    ||||||||||||||| |||| ||||||||  |||| ||| ||| |||||||||||||    
T  19432304 agtcagttttagggggtgatctttattttggtgggtgttatccctatgggtgttgat 19432360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 5)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 351 - 442
Target Start/End: Original strand, 12794212 - 12794303
Alignment:
Q  351 aggttgcgtggtgggggaagctgaatgatctttagagaaggagttcttcggatgtggcttggtgttggtgttgaggacttggttctctttta 442  Q
    |||||||| ||||| |||||| || ||||||||||| ||||| |||||| |||||| || |||||||| |||||||||| | ||||||||||    
T  12794212 aggttgcgcggtggtggaagcagattgatctttagaaaaggatttcttcagatgtgactcggtgttggggttgaggactggtttctctttta 12794303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 548 - 592
Target Start/End: Complemental strand, 6946949 - 6946905
Alignment:
Q  548 ttgtccttatgggtgttgatcgcaaggttgtctttgttggtgttt 592  Q
    ||||||||||||||||||||||||||| |||||||||||||||||    
T  6946949 ttgtccttatgggtgttgatcgcaagggtgtctttgttggtgttt 6946905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 511 - 607
Target Start/End: Original strand, 9224201 - 9224294
Alignment:
Q  511 agtcagttttaggggatgatatttatttttatgggagttgtccttatgggtgttgatcgcaaggttgtctttgttggtgtttattttcaggtgttcc 607  Q
    |||||||||||||||  ||| |||||||| |||||  |   ||||||||| |||||||||| || ||||||||||||||||||||||| ||||||||    
T  9224201 agtcagttttagggg--gatgtttattttgatgggtttatcccttatggg-gttgatcgcagggatgtctttgttggtgtttattttcgggtgttcc 9224294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 354 - 443
Target Start/End: Complemental strand, 26215989 - 26215899
Alignment:
Q  354 ttgcgtggtgggggaagctgaatgatctttagagaaggagtt-cttcggatgtggcttggtgttggtgttgaggacttggttctcttttac 443  Q
    ||||| ||||| ||||||||| |||||||| || |||||||| ||||  ||||||||  ||||||||| |||||||| | |||||||||||    
T  26215989 ttgcgcggtggtggaagctgattgatctttggaaaaggagtttcttcaaatgtggctcagtgttggtgatgaggactagtttctcttttac 26215899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 208 - 287
Target Start/End: Original strand, 28963550 - 28963630
Alignment:
Q  208 ggtttcacttgagtgatataa-tttttggtgatattaatgtattttatagtagagagaacgatgaatgaatgattaaaata 287  Q
    |||||||||||||||| || | |||||||||| |||| || |||||| |  |||||||| || ||||||||||||||||||    
T  28963550 ggtttcacttgagtgacattagtttttggtgacattagtgcattttagatgagagagaatgaagaatgaatgattaaaata 28963630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University