View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11833_low_48 (Length: 242)

Name: NF11833_low_48
Description: NF11833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11833_low_48
NF11833_low_48
[»] chr4 (1 HSPs)
chr4 (45-223)||(30463452-30463630)


Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 45 - 223
Target Start/End: Complemental strand, 30463630 - 30463452
Alignment:
Q  45 tgagaaaagcttagaaatggtatagggtttatattgtaagatagttttgtgaaggatagagagaacgtgtgttcaaataatggagtgtttggtgagtgaa 144  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  30463630 tgagaaaagcttagaaatggtatagggtttatattgtaagatagttttgtgaaggatagagagaacgtgtgttcaaataatggagagtttggtgagtgaa 30463531  T
Q  145 gaaattgtagcaatgatatgatttatgttgccatttttggaagtggtgccaagagagtatgtagagaaggagatttgat 223  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  30463530 gaaattgtagcaatgatatgatttatgttgccatttttggaagtggtgccaagagagtatgtagagaaggagatttgat 30463452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University