View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11831_low_26 (Length: 242)

Name: NF11831_low_26
Description: NF11831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11831_low_26
NF11831_low_26
[»] chr7 (2 HSPs)
chr7 (19-242)||(25320976-25321200)
chr7 (152-199)||(25326881-25326928)


Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 19 - 242
Target Start/End: Original strand, 25320976 - 25321200
Alignment:
Q  19 tatttcaccctagaccaatcatccaacgatgaattactagatgttttttggcctgaaaaacccaaagacataccatacatatgagaaataggaaggttga 118  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| || |||||||||||||||| ||||||||||||||||||||    
T  25320976 tatttcaccctagaccaatcatccaacgatgaattactaaatgttttttggcctgaaaatcc-aaagacataccatacaaatgagaaataggaaggttga 25321074  T
Q  119 attgaataattatcataaatttgaaaaatat--ggtaccgttttcatgtatgtaaattggaaaatttccataattgttcttcatccagtctagcacacct 216  Q
    |||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  25321075 attgaataattatcataaatttgaaaaatatatggtaccgttttcatgtatgtaaattggaaactttccataattgttcttcatccagtctagcacacct 25321174  T
Q  217 tgcaaaatccatggtgtaattggatt 242  Q
    ||||||||||||||||||||||||||    
T  25321175 tgcaaaatccatggtgtaattggatt 25321200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 152 - 199
Target Start/End: Original strand, 25326881 - 25326928
Alignment:
Q  152 taccgttttcatgtatgtaaattggaaaatttccataattgttcttca 199  Q
    |||| ||||||||||||||||||||||||||||||||||  |||||||    
T  25326881 taccattttcatgtatgtaaattggaaaatttccataatcattcttca 25326928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University