View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11827_low_38 (Length: 307)

Name: NF11827_low_38
Description: NF11827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11827_low_38
NF11827_low_38
[»] chr8 (1 HSPs)
chr8 (7-291)||(43452364-43452648)


Alignment Details
Target: chr8 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 7 - 291
Target Start/End: Original strand, 43452364 - 43452648
Alignment:
Q  7 gaagcagagatgagataattgcatcttcggttgtcaagactttgttctctgaaaaagcacttggagctattgttggcagtttaggagctgaatgggcaga 106  Q
    ||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43452364 gaagcagtgatgagataattgcatcttcgattgtcaagactttgttctctgaaaaagcacttggagctattgttggcagtttaggagctgaatgggcaga 43452463  T
Q  107 ggagaggattgttgcagtggagatcttattaagatgcatgcaagaggatgggacttgtaggaacaccattgctgacaaagcagagctctcttctattatg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43452464 ggagaggattgttgcagtggagatcttattaagatgcatgcaagaggatgggacttgtaggaacaccattgctgacaaagcagagctctcttctattatg 43452563  T
Q  207 gagagcttcatccatgcaaatgatgcagaacgtttcaagattgttgaannnnnnnctgagttgatcaaactaaataggtatatct 291  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||| ||||||||||||||||    
T  43452564 gagagcttcatccatgcaaatgatgcagaacgtttcaagattgttgaatttttttctgagttgatcaagctaaataggtatatct 43452648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University