View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11826_low_55 (Length: 232)

Name: NF11826_low_55
Description: NF11826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11826_low_55
NF11826_low_55
[»] chr2 (1 HSPs)
chr2 (1-98)||(6753032-6753129)
[»] chr4 (1 HSPs)
chr4 (2-98)||(1811405-1811501)
[»] chr8 (1 HSPs)
chr8 (148-209)||(1028280-1028341)


Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 6753032 - 6753129
Alignment:
Q  1 gattgtgcaatttctgaagctcgtggacactctggagggatatggatattaaaatctcaaaattgcacatatgatattgagattatagataactattt 98  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6753032 gattgtgcaatttctgaagctcgtggacactctggagggatatggatattaaaatctcaaaattgcacatatgatattgagattatagataactattt 6753129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 2 - 98
Target Start/End: Complemental strand, 1811501 - 1811405
Alignment:
Q  2 attgtgcaatttctgaagctcgtggacactctggagggatatggatattaaaatctcaaaattgcacatatgatattgagattatagataactattt 98  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1811501 attgtgcaatttctgaagctcgtggacactctggaggtatatggatattaaaatctcaaaattgcacatatgatattgagattatagataactattt 1811405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 148 - 209
Target Start/End: Complemental strand, 1028341 - 1028280
Alignment:
Q  148 tctgttctgtcctatctattatgcaagtcgtaccggattcaatggtggtgatggtgatgata 209  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  1028341 tctgttctgtcctatctattatgcaagttgtaccggattcaatggtggtgatggtgatgata 1028280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University