View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11816_high_24 (Length: 228)

Name: NF11816_high_24
Description: NF11816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11816_high_24
NF11816_high_24
[»] chr3 (1 HSPs)
chr3 (1-81)||(34127838-34127918)
[»] chr1 (1 HSPs)
chr1 (1-80)||(48558114-48558192)


Alignment Details
Target: chr3 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 34127838 - 34127918
Alignment:
Q  1 agttggtctttctgttttgctcgtctcaaattgaccaagtccttgttnnnnnnnttacaaaatgttggtctgatctgcata 81  Q
    ||||||| |||||||||| ||||||||||||||||||||||||||||       |||||||| ||||||||||||||||||    
T  34127838 agttggtttttctgttttcctcgtctcaaattgaccaagtccttgttaaaaaaattacaaaaggttggtctgatctgcata 34127918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 48558114 - 48558192
Alignment:
Q  1 agttggtctttctgttttgctcgtctcaaattgaccaagtccttgttnnnnnnnttacaaaatgttggtctgatctgcat 80  Q
    |||||||||||||||||| |||||||||||||| |||||||||||||       ||||||||||||||||||||||||||    
T  48558114 agttggtctttctgttttcctcgtctcaaattggccaagtccttgtt-ctaaaattacaaaatgttggtctgatctgcat 48558192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University