View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11815_low_9 (Length: 235)

Name: NF11815_low_9
Description: NF11815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11815_low_9
NF11815_low_9
[»] chr7 (1 HSPs)
chr7 (93-218)||(21436960-21437085)


Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 93 - 218
Target Start/End: Original strand, 21436960 - 21437085
Alignment:
Q  93 gttttgcatataaccaatcaacaatgaagccaaaacaacagcacctgtcataagactaataacaataccagcaacagcaccagaactcaatgaagaattc 192  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  21436960 gttttgcatataaccaatcaacaaagaagccaaaacaacagcacctgtcataagactaataacaataccagcaacagcaccagaactcaatgaagaattc 21437059  T
Q  193 ttactacaactttgcaaaggtgtacc 218  Q
    ||||||||||||||||||||||||||    
T  21437060 ttactacaactttgcaaaggtgtacc 21437085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University