View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11814_high_34 (Length: 242)

Name: NF11814_high_34
Description: NF11814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11814_high_34
NF11814_high_34
[»] chr1 (1 HSPs)
chr1 (1-217)||(19901117-19901332)


Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 19901117 - 19901332
Alignment:
Q  1 tttgtcgcataaggctcaggaatagaatcagaatgtgtaggttgttcgtttgcaatgatttttacctcacatgattcagcttgtaccgtgccatgttctg 100  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  19901117 tttgtcgcataaggcccaggaatagaatcagaatgtgtaggttgttcgtttgcaatgatttttacctcacatgattcagcttgtaccgtgccatgttctg 19901216  T
Q  101 taggtgcatattgtgaatacctattgctgaacgataggaatgtcaacattcagtgtctcgaatgccttagatgagccgatgcttaaaggattctcttttg 200  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| ||||| | |||||||||||||||| |||||||||||||||    
T  19901217 taggtgcatattgtg-atacctattgctgaacgataggaatgtcaacattcagtctctcaaatgcatcagatgagccgatgcttgaaggattctcttttg 19901315  T
Q  201 tcagccaaccttgcaat 217  Q
    |||||||||||||||||    
T  19901316 tcagccaaccttgcaat 19901332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University