View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11810_high_19 (Length: 240)

Name: NF11810_high_19
Description: NF11810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11810_high_19
NF11810_high_19
[»] chr2 (1 HSPs)
chr2 (1-143)||(25784952-25785093)


Alignment Details
Target: chr2 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 143
Target Start/End: Original strand, 25784952 - 25785093
Alignment:
Q  1 tagaatgctacaaagactcgagtagggagatgctgcaaaataatttgtcattatt--agactatattaaacattggcaactcttttattttttgttaaag 98  Q
    |||||||||||||||||| | ||||||||||||||| |||||||||||||| |||  |||||||||| ||||||||||||| |||| ||| |||||||||    
T  25784952 tagaatgctacaaagacttgtgtagggagatgctgcgaaataatttgtcatcattggagactatatt-aacattggcaact-ttttttttgttgttaaag 25785049  T
Q  99 cttgtaaaaatataaagaatatcatcgaaaataatccaaattgaa 143  Q
    |||||||||| ||||| ||||||||||||||||||||||||||||    
T  25785050 cttgtaaaaa-ataaaaaatatcatcgaaaataatccaaattgaa 25785093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University