View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11804_high_25 (Length: 219)

Name: NF11804_high_25
Description: NF11804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11804_high_25
NF11804_high_25
[»] chr1 (1 HSPs)
chr1 (37-219)||(12607985-12608167)


Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 37 - 219
Target Start/End: Original strand, 12607985 - 12608167
Alignment:
Q  37 tagagtatggttttattaggctgttcagctttattgggtattttagtctacagagaagttttcactgcaaacatttagaggcttttgagttttgacgatt 136  Q
    |||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  12607985 tagagtatggttttattaggctgttcagctttattgagtattttactctacagagaagttttcactgcaaacatttagaggcttttgagttttgacgatt 12608084  T
Q  137 caacgatatacaattcaagtatctgagtttgagttgttggtgcacccttccttgcctgcattctagcttaccttccttcattc 219  Q
    ||| |||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  12608085 caaggatatacaattcgagtatctgagtttgagttgttggtgcacccttccttggctgcattctagcttaccttccttcattc 12608167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University