View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11784_low_33 (Length: 242)

Name: NF11784_low_33
Description: NF11784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11784_low_33
NF11784_low_33
[»] chr8 (3 HSPs)
chr8 (1-201)||(62289-62489)
chr8 (157-221)||(8439334-8439398)
chr8 (193-224)||(61422-61453)
[»] chr1 (1 HSPs)
chr1 (192-224)||(18064-18096)


Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 62489 - 62289
Alignment:
Q  1 tattagagtaaatgtcacttttctagcttaatagaagatgaattaggatttgttgatgcagcgaaataacacagtttcgcagggttttcaataatagcca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  62489 tattagagtaaatgtcacttttctagcttaatagaagatgaattaggatttgttgatgcagcgaaataacacagtttcgcagggttttcaataatagcca 62390  T
Q  101 ttaaatttttccccnnnnnnntaaaataatagccattaaattttatcggatgctactattacacttttgtcaaactcatccaatggttgggataacaact 200  Q
    ||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  62389 ttaaatttttccccaaaaaaataaaataatagccattaaattttatcggatgctactattacacttttgtcaaactcatccaatggttgggataacaact 62290  T
Q  201 g 201  Q
    |    
T  62289 g 62289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 221
Target Start/End: Original strand, 8439334 - 8439398
Alignment:
Q  157 tattacacttttgtcaaactcatccaatggttgggataacaactgtgttgttttttacagcactg 221  Q
    ||||| |||||||| ||||  |||||||| |||| ||||||||||||||||||||||||||||||    
T  8439334 tattatacttttgttaaaccaatccaatgattggaataacaactgtgttgttttttacagcactg 8439398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 193 - 224
Target Start/End: Complemental strand, 61453 - 61422
Alignment:
Q  193 taacaactgtgttgttttttacagcactgaat 224  Q
    ||||||||||||||||||||||||||||||||    
T  61453 taacaactgtgttgttttttacagcactgaat 61422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 192 - 224
Target Start/End: Complemental strand, 18096 - 18064
Alignment:
Q  192 ataacaactgtgttgttttttacagcactgaat 224  Q
    ||||||| |||||||||||||||||||||||||    
T  18096 ataacaattgtgttgttttttacagcactgaat 18064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University