View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11780_low_42 (Length: 325)

Name: NF11780_low_42
Description: NF11780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11780_low_42
NF11780_low_42
[»] chr1 (1 HSPs)
chr1 (14-307)||(48153484-48153786)


Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 14 - 307
Target Start/End: Original strand, 48153484 - 48153786
Alignment:
Q  14 agacgggttcaattggtggtagaggtgtatcatagcgcctacgaacacgaccacgcccaccacggccccttccaccagcaaggtgagcttgatcggcttc 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48153484 agacgggttcaattggtggtagaggtgtatcatagcgcctacgaacacgaccacgcccaccacggccccttccaccagcaaggtgagcttgatcggcttc 48153583  T
Q  114 tggatgttgcggatatggtccctcaaccacaggcataagaacatgaccacgcccatgc---------ccacggccccttcggccagcaaggtgagcttga 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         |||||||||||||||||||||||||||||||||    
T  48153584 tggatgttgcggatatggtccctcaaccacaggcataagaacatgaccacgcccatgcccacggccaccacggccccttcggccagcaaggtgagcttga 48153683  T
Q  205 tcagcttctgccacatgcattggagcagttcgatatccacttcataataaagagaaacttcagacataatgtacagaataatttgacataagcaggagta 304  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48153684 tcagcttctgccacatgcattggagcagttcgatatccacttcataacaaagagaaacttcagacataatgtacagaataatttgacataagcaggagta 48153783  T
Q  305 ttt 307  Q
    |||    
T  48153784 ttt 48153786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University