View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11780_low_40 (Length: 355)

Name: NF11780_low_40
Description: NF11780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11780_low_40
NF11780_low_40
[»] chr7 (2 HSPs)
chr7 (194-345)||(47126999-47127150)
chr7 (36-148)||(47127200-47127312)


Alignment Details
Target: chr7 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 194 - 345
Target Start/End: Complemental strand, 47127150 - 47126999
Alignment:
Q  194 gcaacttactaagtatcaattttaaaaatatgtacatacatttgtaaatatatatgagatgagaattacattggaaaatataaaattaacacatgtatat 293  Q
    |||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47127150 gcaactcactaagtatcaattttaaaaatatgtacatacatgtgtaaatatatatgagatgagaattacattggaaaatataaaattaacacatgtatat 47127051  T
Q  294 tatagaactttgcacctgaaaacccagcttttaataaatttggtcgcctatg 345  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47127050 tatagaactttgcacctgaaaacccagcttttaataaatttggtcgcctatg 47126999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 36 - 148
Target Start/End: Complemental strand, 47127312 - 47127200
Alignment:
Q  36 aacattgtacttatacactttaccacatgatgataattgaaaatgtaaacggtaacatggaaaacttacgaaatgcatcacattgcccttcaaccggaag 135  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  47127312 aacattgtacttatacactttaccacatgatgataattgaaaatgtaaacggtaacatggaaaacttacgaaacgcatcacattgcccttcaaccggaag 47127213  T
Q  136 cttcaagtcatct 148  Q
    |||||||||||||    
T  47127212 cttcaagtcatct 47127200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University