View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11778_low_42 (Length: 284)

Name: NF11778_low_42
Description: NF11778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11778_low_42
NF11778_low_42
[»] chr5 (2 HSPs)
chr5 (121-274)||(11829955-11830109)
chr5 (25-90)||(11829889-11829954)


Alignment Details
Target: chr5 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 121 - 274
Target Start/End: Original strand, 11829955 - 11830109
Alignment:
Q  121 aaatatatgttggtgagaaatgatatttgtacaatgg-ataacttttagacaactaactgataaggtgaaaaccttatgcaagtcttaaaagctgtcata 219  Q
    ||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
T  11829955 aaatacatgttggtgagaaatgatatttgtacaatgggataacttttagacaactaactgataaggtgaaaaccttctgcaagtcttaaaagctgtcata 11830054  T
Q  220 tatgcccacaaactttttaaaccaatcctacctaaaagaagccactgttttctca 274  Q
    ||||||||||||||||||||||||||||| |||||| ||||||||||||||||||    
T  11830055 tatgcccacaaactttttaaaccaatccttcctaaatgaagccactgttttctca 11830109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 25 - 90
Target Start/End: Original strand, 11829889 - 11829954
Alignment:
Q  25 aattagaggataaaattatattagtatgtttactatttttgaaaacacaatccaatagctggtgaa 90  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  11829889 aattagaggatgaaattatattagtatgtttactatttttgaaaacaccatccaatagctggtgaa 11829954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University