View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11762_low_20 (Length: 249)

Name: NF11762_low_20
Description: NF11762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11762_low_20
NF11762_low_20
[»] chr1 (1 HSPs)
chr1 (19-234)||(1252337-1252555)


Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 19 - 234
Target Start/End: Original strand, 1252337 - 1252555
Alignment:
Q  19 acctcccttgaggtttccccttaaacaaacgtttgttacttaaccccggccaccaccaaaaataaattcacagctgaatttccaatgctagnnnnnnnnt 118  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||        |    
T  1252337 acctcccatgaggtttccccttaaacaaacgtttgttacttaaccccggccaccaacaaaaataaattcacagctgaatttccaatgctagaacgaaaat 1252436  T
Q  119 taagatgttggtttgtcaaaagagaggttctataacatagatttctcatctttcacatagttttctggatctgt---cttcgtcagcttttcgattacga 215  Q
    || |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||   |||||||||||||||||||||||    
T  1252437 tacgatgttggtttgtcaaaagagaggttctataacatagatttctcatgtttcacatagttttctggatctgtcgacttcgtcagcttttcgattacga 1252536  T
Q  216 ttttctctctcggatctgt 234  Q
    |||||||||||||||||||    
T  1252537 ttttctctctcggatctgt 1252555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University