View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1175_low_15 (Length: 330)

Name: NF1175_low_15
Description: NF1175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1175_low_15
NF1175_low_15
[»] chr1 (1 HSPs)
chr1 (67-307)||(6315070-6315310)


Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 67 - 307
Target Start/End: Complemental strand, 6315310 - 6315070
Alignment:
Q  67 ctgttgccatatgacaagtacccctgttgtggttttttccatctactatatgcctcgtgttaatctccaaattctaagtattttgctgctttttcttttg 166  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6315310 ctgttgccatatgacaagtacccctgttgtggtcttttccatctactatatgcctcgtgttaatctccaaattctaagtattttgctgctttttcttttg 6315211  T
Q  167 ccatttcaaaacaacagggaactaaatagcttgttggattgttgccaggcatattccaaagctgcttacttcttctcttccatatattccacaacaccat 266  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6315210 ccatttcaaaacaacagggaactaaatagcttgttggattgttgccaggcatattccaaagctgcttacttcttctcttccatatattccacaacaccat 6315111  T
Q  267 agttaaaccattcataatcattgttgtgcagttgttgatga 307  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  6315110 agttaaaccattcataatcattgttgtgcagttgttgatga 6315070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University