View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11755_high_37 (Length: 236)

Name: NF11755_high_37
Description: NF11755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11755_high_37
NF11755_high_37
[»] chr2 (2 HSPs)
chr2 (35-224)||(5361017-5361206)
chr2 (16-50)||(5361251-5361285)


Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 35 - 224
Target Start/End: Complemental strand, 5361206 - 5361017
Alignment:
Q  35 aatgaatttgtaagtatttgtttattattttcatgtataatctgnnnnnnnagtactgtccatttataatctttaaactcttgataagaacggtttttgc 134  Q
    ||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||    
T  5361206 aatgaatttgtaagtatttgtttattattttcatgtataatctgtttttttagtactgtccatttataatctttaaactcttgataagaacggtttttgc 5361107  T
Q  135 catataaaccaattcgagaaatgtccaataatatgtttttccttatacaatagtattgccttttaaaaaacttttcttatatgatttttg 224  Q
    ||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| ||||||||||||||    
T  5361106 catataaaccaattcgagaaatgtccaataatatgatttttcttatacaatagtattgccttttaaaaaactttttttatatgatttttg 5361017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 50
Target Start/End: Complemental strand, 5361285 - 5361251
Alignment:
Q  16 atgaaaaaatttacgattcaatgaatttgtaagta 50  Q
    |||||||| ||||||||||||||||||||||||||    
T  5361285 atgaaaaagtttacgattcaatgaatttgtaagta 5361251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University