View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11752_low_13 (Length: 207)

Name: NF11752_low_13
Description: NF11752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11752_low_13
NF11752_low_13
[»] chr1 (1 HSPs)
chr1 (1-189)||(4132486-4132674)


Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 4132674 - 4132486
Alignment:
Q  1 caatttctctgcataactacagatttctagtgtgtgggcgtattttatttgcaaggtagctgagttttcaatactagcagttttaactgttgtggagtcc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4132674 caatttctctgcataactacagatttctagtgtgtgggcgtattttatttgcaaggtagctgagttttcaatactagcagttttaactgttgtggagtcc 4132575  T
Q  101 tggagaataattgaaatcggcgtggattgcatatatagagtgagggagtatttcatatgatggcagaatttgatcagtgggggtccgag 189  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  4132574 tggagaataattgaaatcggcgtggattgcatatatagagtgagggagtatttcatatcatggcagaatttgatcagtgggggtccgag 4132486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University