View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11749_high_13 (Length: 222)

Name: NF11749_high_13
Description: NF11749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11749_high_13
NF11749_high_13
[»] chr2 (1 HSPs)
chr2 (14-169)||(38238054-38238209)


Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 14 - 169
Target Start/End: Original strand, 38238054 - 38238209
Alignment:
Q  14 cacagaggtagctactgacactgatattctcaccggacgtgctatcaatgctgcaattgttctcggatttggagcttttgctgtcaccaaattgctcacc 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38238054 cacagaggtagctactgacactgatattctcaccggacgtgctatcaatgctgcaattgttctcggatttggagcttttgctgtcaccaaattgctcacc 38238153  T
Q  114 attgatcatgattactggcatgttagtttcttctagtttatattaaaatttgcttc 169  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
T  38238154 attgatcatgattactggcatgttagtttcttctggtttatattaaaatttgcttc 38238209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University