View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11746_low_67 (Length: 211)

Name: NF11746_low_67
Description: NF11746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11746_low_67
NF11746_low_67
[»] chr5 (1 HSPs)
chr5 (12-186)||(803349-803515)


Alignment Details
Target: chr5 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 12 - 186
Target Start/End: Complemental strand, 803515 - 803349
Alignment:
Q  12 gagcagagaccttaatccgaggacacttatttgaatagacacaatatataaactgaaattaattttagatatcccactctccaattgagaattaatctca 111  Q
    ||||||| |||||||||||||||||||||||||||| |||||||||    |||||||||||||||||||||||||||||||||||||||    |||||||    
T  803515 gagcagacaccttaatccgaggacacttatttgaatggacacaata----aactgaaattaattttagatatcccactctccaattgag----aatctca 803424  T
Q  112 gttcctaatgacgtagtagatctctcatatgnnnnnnnaacttgactttgtcaaatggtaaagactttgctatgc 186  Q
    |||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||| ||||||||    
T  803423 gttcctaatgacgtagtagatctctcatatgtttttttaacttgactttgtcaaatggtaaagactatgctatgc 803349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University