View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11745_high_65 (Length: 400)

Name: NF11745_high_65
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11745_high_65
NF11745_high_65
[»] chr5 (20 HSPs)
chr5 (1-382)||(37254307-37254688)
chr5 (8-70)||(31680345-31680407)
chr5 (1-70)||(31501836-31501905)
chr5 (1-65)||(12278980-12279044)
chr5 (5-65)||(17332675-17332735)
chr5 (18-70)||(26543902-26543954)
chr5 (1-65)||(36291354-36291418)
chr5 (1-48)||(13817977-13818024)
chr5 (1-68)||(26283438-26283505)
chr5 (1-46)||(1776496-1776541)
chr5 (1-65)||(202622-202686)
chr5 (1-48)||(10033927-10033974)
chr5 (1-68)||(39434676-39434743)
chr5 (1-48)||(3155751-3155798)
chr5 (36-65)||(4307238-4307267)
chr5 (36-65)||(15917020-15917049)
chr5 (1-30)||(16155015-16155044)
chr5 (1-46)||(19985941-19985986)
chr5 (1-34)||(28801301-28801334)
chr5 (1-34)||(33430335-33430368)
[»] chr2 (17 HSPs)
chr2 (1-65)||(44084723-44084787)
chr2 (1-65)||(8147334-8147398)
chr2 (1-65)||(45418566-45418630)
chr2 (1-68)||(6403924-6403991)
chr2 (1-68)||(42439966-42440033)
chr2 (1-65)||(770977-771046)
chr2 (1-65)||(8059453-8059517)
chr2 (1-45)||(41251754-41251798)
chr2 (1-48)||(32127261-32127308)
chr2 (18-65)||(34523223-34523270)
chr2 (9-61)||(26237944-26237996)
chr2 (1-69)||(35962694-35962762)
chr2 (4-68)||(17445162-17445226)
chr2 (9-68)||(2958228-2958287)
chr2 (4-45)||(16405603-16405644)
chr2 (1-42)||(18981622-18981663)
chr2 (37-65)||(12756981-12757009)
[»] chr7 (20 HSPs)
chr7 (1-68)||(34389176-34389243)
chr7 (1-65)||(33685547-33685611)
chr7 (5-70)||(8867855-8867920)
chr7 (1-65)||(37002264-37002328)
chr7 (1-68)||(5555467-5555534)
chr7 (1-48)||(8394125-8394172)
chr7 (16-65)||(7002708-7002757)
chr7 (16-65)||(7048579-7048628)
chr7 (5-65)||(26624728-26624789)
chr7 (8-65)||(43184595-43184652)
chr7 (1-48)||(36630816-36630863)
chr7 (1-47)||(14777227-14777273)
chr7 (1-45)||(3114216-3114260)
chr7 (3-65)||(10876829-10876891)
chr7 (12-64)||(37966614-37966666)
chr7 (1-39)||(35090177-35090215)
chr7 (36-65)||(38826584-38826613)
chr7 (16-48)||(26502810-26502842)
chr7 (16-48)||(26589872-26589904)
chr7 (1-29)||(40920123-40920151)
[»] chr1 (14 HSPs)
chr1 (1-70)||(35907530-35907599)
chr1 (1-69)||(26144234-26144302)
chr1 (11-65)||(31866960-31867014)
chr1 (12-65)||(44352614-44352667)
chr1 (1-65)||(3828967-3829031)
chr1 (1-65)||(41972395-41972458)
chr1 (1-48)||(32982176-32982223)
chr1 (7-65)||(321503-321561)
chr1 (1-65)||(17445296-17445360)
chr1 (1-33)||(42311061-42311093)
chr1 (1-68)||(7433425-7433492)
chr1 (36-64)||(10907613-10907641)
chr1 (1-65)||(33489670-33489734)
chr1 (1-65)||(48901225-48901288)
[»] chr4 (33 HSPs)
chr4 (1-65)||(6690355-6690419)
chr4 (1-68)||(43143704-43143771)
chr4 (1-65)||(30216862-30216926)
chr4 (11-65)||(49908782-49908836)
chr4 (7-68)||(7769308-7769369)
chr4 (1-65)||(3293016-3293080)
chr4 (1-65)||(10353004-10353068)
chr4 (1-65)||(50205197-50205261)
chr4 (11-65)||(5517494-5517548)
chr4 (1-68)||(13012168-13012235)
chr4 (1-68)||(20129290-20129357)
chr4 (1-68)||(47500753-47500820)
chr4 (1-59)||(30109945-30110003)
chr4 (1-70)||(34407404-34407473)
chr4 (1-65)||(26448036-26448100)
chr4 (1-69)||(43355883-43355951)
chr4 (1-68)||(26439399-26439466)
chr4 (1-48)||(36382465-36382512)
chr4 (1-68)||(42333896-42333963)
chr4 (12-65)||(6212029-6212082)
chr4 (5-70)||(13392994-13393059)
chr4 (5-70)||(13396133-13396198)
chr4 (12-65)||(17554979-17555032)
chr4 (5-71)||(48129947-48130009)
chr4 (11-64)||(50720476-50720529)
chr4 (1-65)||(29996103-29996167)
chr4 (1-65)||(30077751-30077814)
chr4 (1-65)||(48989311-48989375)
chr4 (1-68)||(25930688-25930755)
chr4 (1-71)||(28877370-28877440)
chr4 (12-65)||(12680193-12680246)
chr4 (1-65)||(45194159-45194223)
chr4 (1-45)||(29319825-29319869)
[»] chr3 (18 HSPs)
chr3 (1-65)||(45182964-45183028)
chr3 (5-69)||(6503693-6503757)
chr3 (1-65)||(6931014-6931078)
chr3 (1-68)||(11018332-11018399)
chr3 (1-68)||(27935158-27935225)
chr3 (1-65)||(19565621-19565685)
chr3 (5-65)||(33040936-33040996)
chr3 (11-65)||(6890981-6891035)
chr3 (1-65)||(45335858-45335922)
chr3 (9-65)||(5354692-5354748)
chr3 (9-65)||(35514249-35514305)
chr3 (1-48)||(34084242-34084289)
chr3 (1-68)||(39771770-39771837)
chr3 (1-47)||(22968564-22968610)
chr3 (1-48)||(19390146-19390193)
chr3 (1-48)||(22922157-22922204)
chr3 (1-47)||(6269546-6269592)
chr3 (1-34)||(40081859-40081892)
[»] chr8 (12 HSPs)
chr8 (1-65)||(2729316-2729380)
chr8 (5-65)||(23402091-23402151)
chr8 (1-61)||(36408538-36408598)
chr8 (1-68)||(4403988-4404055)
chr8 (1-68)||(34136945-34137012)
chr8 (1-62)||(16788145-16788206)
chr8 (69-117)||(39977576-39977624)
chr8 (1-47)||(39914516-39914562)
chr8 (1-61)||(10397160-10397220)
chr8 (1-48)||(15838286-15838333)
chr8 (1-36)||(3648914-3648949)
chr8 (1-48)||(29728506-29728553)
[»] chr6 (10 HSPs)
chr6 (1-65)||(28996713-28996777)
chr6 (1-64)||(24697937-24698000)
chr6 (12-65)||(13647000-13647053)
chr6 (1-62)||(31028484-31028545)
chr6 (1-68)||(398597-398664)
chr6 (12-65)||(34385519-34385572)
chr6 (1-65)||(29743266-29743330)
chr6 (1-48)||(18339106-18339153)
chr6 (1-70)||(34948878-34948947)
chr6 (11-65)||(21149331-21149385)
[»] scaffold0154 (1 HSPs)
scaffold0154 (3-65)||(31463-31525)
[»] scaffold0002 (1 HSPs)
scaffold0002 (1-69)||(480577-480645)
[»] scaffold2142 (1 HSPs)
scaffold2142 (1-68)||(502-569)
[»] scaffold0769 (1 HSPs)
scaffold0769 (18-65)||(1260-1307)
[»] scaffold0502 (1 HSPs)
scaffold0502 (1-48)||(5230-5277)
[»] scaffold0012 (1 HSPs)
scaffold0012 (18-55)||(194021-194058)
[»] scaffold0069 (1 HSPs)
scaffold0069 (1-68)||(17822-17889)
[»] scaffold0041 (1 HSPs)
scaffold0041 (1-29)||(52944-52972)


Alignment Details
Target: chr5 (Bit Score: 366; Significance: 0; HSPs: 20)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 366; E-Value: 0
Query Start/End: Original strand, 1 - 382
Target Start/End: Complemental strand, 37254688 - 37254307
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatgccaccaccattggctgcaatttttctgaaagc 100  Q
    |||||||||||||||||||||||||| ||||||| ||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37254688 aatgtgcaaaaattatcgatcgagcctgggcgaccgcctggggtcgccgagcggtgaaaccgcccatgccaccaccattggctgcaatttttctgaaagc 37254589  T
Q  101 acgatgacaaccacaacttgaaaccagaataataatttgaactacacaccgtcttgggatccagagatacacataaaaacgtgtggtatgaagctcctct 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37254588 acgatgacaaccacaacttgaaaccagaataataatttgaactacacaccgtcttgggatccagagatacacataaaaacgtgtggtatgaagctcctct 37254489  T
Q  201 cctatctccatatccgtcttcttttggcgacataacaaactccggcgaggctccggcgttgcttcgatgtgggattttcaccattttttcgcgttttccc 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37254488 cctatctccatatccgtcttcttttggcgacataacaaactccggcgaggctccggcgttgcttcgatgtgggattttcaccattttttcgcgttttccc 37254389  T
Q  301 ttggattctctggtgattgtttccttttgggttcttgatttgttctggtactcttggcggtggtttgttccttcaccatagt 382  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37254388 ttggattctctggtgattgtttccttttgggttcttgatttgttctggtactcttggcggtggtttgttccttcaccatagt 37254307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 8 - 70
Target Start/End: Complemental strand, 31680407 - 31680345
Alignment:
Q  8 aaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatgcc 70  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||    
T  31680407 aaaaattatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctgcc 31680345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 31501836 - 31501905
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatgcc 70  Q
    ||||||||||||||||||||||||||||||| |  |||||||||||||||||||||||||||||| ||||    
T  31501836 aatgtgcaaaaattatcgatcgagcccgggcaatcgcccggggtcgccgggcggtgaaaccgcccctgcc 31501905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 12278980 - 12279044
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||||||||||||||||||||| ||||||||| ||||||| ||||||||||||||||||||||    
T  12278980 aatgtgcaaaaattatcgatcgagtccgggcgaccgcccgggatcgccgggcggtgaaaccgccc 12279044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 5 - 65
Target Start/End: Original strand, 17332675 - 17332735
Alignment:
Q  5 tgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||    
T  17332675 tgcaaaaattatcgatcgagcccgggcgaacgcccggggtcgccgggcggtgaaaccgccc 17332735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 26543902 - 26543954
Alignment:
Q  18 gatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatgcc 70  Q
    ||||||||||||||||| |||||||||||||||||||| ||||||||| ||||    
T  26543902 gatcgagcccgggcgaccgcccggggtcgccgggcggtaaaaccgcccctgcc 26543954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 36291418 - 36291354
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||||||||||||| |||||| ||||| |||| |||||| |||| ||||||||||||||||||    
T  36291418 aatgtgcaaaaattattgatcgaacccggacgaccgcccggagtcggcgggcggtgaaaccgccc 36291354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 13818024 - 13817977
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgcc 48  Q
    |||||||||||||||||||||||||||| ||||| |||||||||||||    
T  13818024 aatgtgcaaaaattatcgatcgagcccgagcgaccgcccggggtcgcc 13817977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 26283438 - 26283505
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatg 68  Q
    |||||||||||||||||||||||||||||||||| ||||| ||||||    ||||| |||||||||||    
T  26283438 aatgtgcaaaaattatcgatcgagcccgggcgaccgcccgaggtcgctacacggtggaaccgcccatg 26283505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 1776496 - 1776541
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcg 46  Q
    ||||| |||||||||||||||||||||||||||| |||||||||||    
T  1776496 aatgtacaaaaattatcgatcgagcccgggcgaccgcccggggtcg 1776541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 202686 - 202622
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    ||||| || |||||||||||||||||||||||||  ||  |||||| ||||||||||||||||||    
T  202686 aatgtacacaaattatcgatcgagcccgggcgaccacctagggtcgtcgggcggtgaaaccgccc 202622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 10033974 - 10033927
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgcc 48  Q
    |||||||||||||||||||||||||||||||||  | |||||||||||    
T  10033974 aatgtgcaaaaattatcgatcgagcccgggcgatcgtccggggtcgcc 10033927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 39434743 - 39434676
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatg 68  Q
    |||||| ||||||||||||||||||||||||||| |||| ||||||||   ||||  |||||||||||    
T  39434743 aatgtgaaaaaattatcgatcgagcccgggcgaccgcccagggtcgccacacggtagaaccgcccatg 39434676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 3155751 - 3155798
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgcc 48  Q
    |||||||||||||||| ||||||||||| ||||| ||||||| |||||    
T  3155751 aatgtgcaaaaattattgatcgagcccgagcgaccgcccgggatcgcc 3155798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 36 - 65
Target Start/End: Original strand, 4307238 - 4307267
Alignment:
Q  36 gcccggggtcgccgggcggtgaaaccgccc 65  Q
    ||||||||||||||||||||||||||||||    
T  4307238 gcccggggtcgccgggcggtgaaaccgccc 4307267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 36 - 65
Target Start/End: Complemental strand, 15917049 - 15917020
Alignment:
Q  36 gcccggggtcgccgggcggtgaaaccgccc 65  Q
    ||||||||||||||||||||||||||||||    
T  15917049 gcccggggtcgccgggcggtgaaaccgccc 15917020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 16155044 - 16155015
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccggg 30  Q
    ||||||||||||||||||||||||||||||    
T  16155044 aatgtgcaaaaattatcgatcgagcccggg 16155015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 19985986 - 19985941
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcg 46  Q
    ||||||||||||||||||||||||| ||| |||| ||||| |||||    
T  19985986 aatgtgcaaaaattatcgatcgagctcggacgaccgcccgaggtcg 19985941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 28801334 - 28801301
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgac 34  Q
    |||||||||||||||||||||||||| |||||||    
T  28801334 aatgtgcaaaaattatcgatcgagccagggcgac 28801301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 33430368 - 33430335
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgac 34  Q
    |||| |||||||||||||||||||||||||||||    
T  33430368 aatgcgcaaaaattatcgatcgagcccgggcgac 33430335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 65; Significance: 2e-28; HSPs: 17)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 44084723 - 44084787
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44084723 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 44084787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 8147398 - 8147334
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  8147398 aatgtgcaaagattatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgccc 8147334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 45418630 - 45418566
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  45418630 aatgcgcaaaaattatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgccc 45418566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 6403924 - 6403991
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatg 68  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||    ||||| |||||||||||    
T  6403924 aatgtgcaaaaattatcgatcgagcccgggcgaccgcccggggtcgctacacggtggaaccgcccatg 6403991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 42440033 - 42439966
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatg 68  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||   ||||  |||||||||||    
T  42440033 aatgtgcaaaaattatcgatcgagcccgggcgaccgcccggggtcgccatacggtagaaccgcccatg 42439966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 771046 - 770977
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccgg-----ggtcgccgggcggtgaaaccgccc 65  Q
    ||||||||||| |||||||||||||||||||||| ||||||     ||||||||||||||||||||||||    
T  771046 aatgtgcaaaagttatcgatcgagcccgggcgaccgcccgggatccggtcgccgggcggtgaaaccgccc 770977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 8059453 - 8059517
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||||||||||||||||| ||||| ||||||  | ||||||||| ||||||||||||||||||    
T  8059453 aatgtgcaaaaattatcgattgagcctgggcgatcggccggggtcgtcgggcggtgaaaccgccc 8059517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 41251754 - 41251798
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtc 45  Q
    |||||||||||||||||||||||||||||||||| ||||||||||    
T  41251754 aatgtgcaaaaattatcgatcgagcccgggcgaccgcccggggtc 41251798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 32127261 - 32127308
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgcc 48  Q
    |||||||||||||||| ||||||||||||||||| |||||||||||||    
T  32127261 aatgtgcaaaaattattgatcgagcccgggcgaccgcccggggtcgcc 32127308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 18 - 65
Target Start/End: Complemental strand, 34523270 - 34523223
Alignment:
Q  18 gatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    ||||||||||||||||| |||||||||||||||||||| |||||||||    
T  34523270 gatcgagcccgggcgaccgcccggggtcgccgggcggtaaaaccgccc 34523223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 9 - 61
Target Start/End: Complemental strand, 26237996 - 26237944
Alignment:
Q  9 aaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaacc 61  Q
    |||| ||||||||||||||||||||| ||||||||||||||||| || |||||    
T  26237996 aaaaatatcgatcgagcccgggcgaccgcccggggtcgccgggctgtaaaacc 26237944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 35962762 - 35962694
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatgc 69  Q
    ||||||||||||||||||||||||||||| |||| ||| |||||||||   ||||  ||||||||||||    
T  35962762 aatgtgcaaaaattatcgatcgagcccggacgaccgcctggggtcgccatacggtagaaccgcccatgc 35962694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 4 - 68
Target Start/End: Original strand, 17445162 - 17445226
Alignment:
Q  4 gtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatg 68  Q
    |||||||||||||||||||||| |||||||| ||||| |||||||   ||||  |||||||||||    
T  17445162 gtgcaaaaattatcgatcgagctcgggcgaccgcccgaggtcgccacacggtagaaccgcccatg 17445226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 9 - 68
Target Start/End: Original strand, 2958228 - 2958287
Alignment:
Q  9 aaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatg 68  Q
    ||||||||||||||||||||| |||| |||||||||||||   ||||  |||||||||||    
T  2958228 aaaattatcgatcgagcccggacgaccgcccggggtcgccatacggtagaaccgcccatg 2958287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 4 - 45
Target Start/End: Complemental strand, 16405644 - 16405603
Alignment:
Q  4 gtgcaaaaattatcgatcgagcccgggcgactgcccggggtc 45  Q
    ||||||||||||||||| ||||||||||||| |||| |||||    
T  16405644 gtgcaaaaattatcgattgagcccgggcgaccgcccagggtc 16405603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 18981663 - 18981622
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggg 42  Q
    ||||||||||||||||| ||||||||||| |||| |||||||    
T  18981663 aatgtgcaaaaattatcaatcgagcccggacgaccgcccggg 18981622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 37 - 65
Target Start/End: Original strand, 12756981 - 12757009
Alignment:
Q  37 cccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||||||||||||||||||||||||||    
T  12756981 cccggggtcgccgggcggtgaaaccgccc 12757009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 60; Significance: 2e-25; HSPs: 20)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 34389176 - 34389243
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatg 68  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||    
T  34389176 aatgtgcaaaaattatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaatcgcccatg 34389243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 33685611 - 33685547
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||    
T  33685611 aatgtgcaaaaattatcgatcgagcccgagcgactgcctggggtcgccgggcggtgaaaccgccc 33685547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 5 - 70
Target Start/End: Original strand, 8867855 - 8867920
Alignment:
Q  5 tgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatgcc 70  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| ||||    
T  8867855 tgcaaaaattatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaactgcccctgcc 8867920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 37002264 - 37002328
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||||||||||||||||||||| |||  |||| ||||||||||||||||||||||||||||||    
T  37002264 aatgtgcaaaaattatcgatcgagaccgaacgaccgcccggggtcgccgggcggtgaaaccgccc 37002328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 5555534 - 5555467
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatg 68  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||   ||||  |||||||||||    
T  5555534 aatgtgcaaaaattatcgatcgagcccgggcgaccgcccggggtcgccatacggtagaaccgcccatg 5555467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 8394172 - 8394125
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgcc 48  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||    
T  8394172 aatgtgcaaaaattatcgatcgagcccgggcgaccgcccggggtcgcc 8394125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 16 - 65
Target Start/End: Complemental strand, 7002757 - 7002708
Alignment:
Q  16 tcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    ||||||||||||||||||| || |||||||||||||||||||||||||||    
T  7002757 tcgatcgagcccgggcgaccgctcggggtcgccgggcggtgaaaccgccc 7002708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 16 - 65
Target Start/End: Complemental strand, 7048628 - 7048579
Alignment:
Q  16 tcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    ||||||||||||||||||| || |||||||||||||||||||||||||||    
T  7048628 tcgatcgagcccgggcgaccgctcggggtcgccgggcggtgaaaccgccc 7048579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 5 - 65
Target Start/End: Complemental strand, 26624789 - 26624728
Alignment:
Q  5 tgcaaaaattatcga-tcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    ||||||||||||||| |||||||| |||||| ||||||||| ||||||||||||||||||||    
T  26624789 tgcaaaaattatcgaatcgagcccaggcgaccgcccggggttgccgggcggtgaaaccgccc 26624728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 8 - 65
Target Start/End: Original strand, 43184595 - 43184652
Alignment:
Q  8 aaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    ||||||||||||||||||||| ||||| ||||||  ||||||||||||||||||||||    
T  43184595 aaaaattatcgatcgagcccgagcgaccgcccggaatcgccgggcggtgaaaccgccc 43184652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 36630863 - 36630816
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgcc 48  Q
    |||||||||||||||||||||||||||||||||| | |||||||||||    
T  36630863 aatgtgcaaaaattatcgatcgagcccgggcgaccgtccggggtcgcc 36630816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 14777227 - 14777273
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgc 47  Q
    |||||||||||||||||||||||||||||||||| ||||||| ||||    
T  14777227 aatgtgcaaaaattatcgatcgagcccgggcgaccgcccgggatcgc 14777273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 3114216 - 3114260
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtc 45  Q
    |||||||||||||||||||||||||||||||||| | ||||||||    
T  3114216 aatgtgcaaaaattatcgatcgagcccgggcgaccgtccggggtc 3114260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 3 - 65
Target Start/End: Original strand, 10876829 - 10876891
Alignment:
Q  3 tgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    ||||||||||||||||||||||||||||||||  | |||| ||||||||  ||||||| ||||    
T  10876829 tgtgcaaaaattatcgatcgagcccgggcgaccacacgggttcgccgggaagtgaaactgccc 10876891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 12 - 64
Target Start/End: Original strand, 37966614 - 37966666
Alignment:
Q  12 attatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcc 64  Q
    |||||||||||||| ||| |||| ||| | |||||||||||||||||||||||    
T  37966614 attatcgatcgagctcggacgaccgcctgaggtcgccgggcggtgaaaccgcc 37966666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 35090215 - 35090177
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgccc 39  Q
    |||||||||||||||| ||||||||||||||||| ||||    
T  35090215 aatgtgcaaaaattattgatcgagcccgggcgaccgccc 35090177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 36 - 65
Target Start/End: Original strand, 38826584 - 38826613
Alignment:
Q  36 gcccggggtcgccgggcggtgaaaccgccc 65  Q
    ||||||||||||||||||||||||||||||    
T  38826584 gcccggggtcgccgggcggtgaaaccgccc 38826613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 16 - 48
Target Start/End: Complemental strand, 26502842 - 26502810
Alignment:
Q  16 tcgatcgagcccgggcgactgcccggggtcgcc 48  Q
    ||||||||||||||||||||||| |||||||||    
T  26502842 tcgatcgagcccgggcgactgcctggggtcgcc 26502810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 16 - 48
Target Start/End: Original strand, 26589872 - 26589904
Alignment:
Q  16 tcgatcgagcccgggcgactgcccggggtcgcc 48  Q
    ||||||||||||||||||||||| |||||||||    
T  26589872 tcgatcgagcccgggcgactgcctggggtcgcc 26589904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 40920123 - 40920151
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgg 29  Q
    |||||||||||||||||||||||||||||    
T  40920123 aatgtgcaaaaattatcgatcgagcccgg 40920151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 58; Significance: 3e-24; HSPs: 14)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 35907599 - 35907530
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatgcc 70  Q
    ||||||||||||||||||||| |||||||||||| ||||| |||||||||||||||||||||||||||||    
T  35907599 aatgtgcaaaaattatcgatcaagcccgggcgaccgcccgaggtcgccgggcggtgaaaccgcccatgcc 35907530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 26144302 - 26144234
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatgc 69  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||    ||||| ||||||||||||    
T  26144302 aatgtgcaaaaattatcgatcgagcccgggcgaccgcccggggtcgctacacggtggaaccgcccatgc 26144234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 11 - 65
Target Start/End: Complemental strand, 31867014 - 31866960
Alignment:
Q  11 aattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||||| |||| |||||||||| ||||||||||||||||||||||||||||||    
T  31867014 aattatcggtcgaacccgggcgaccgcccggggtcgccgggcggtgaaaccgccc 31866960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 12 - 65
Target Start/End: Original strand, 44352614 - 44352667
Alignment:
Q  12 attatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||||||||||||||||||||  ||||||||||||||  |||||||||||||    
T  44352614 attatcgatcgagcccgggcgacctcccggggtcgccggatggtgaaaccgccc 44352667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 3829031 - 3828967
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    ||||||||||||||||||||||| |||| ||||| | ||||||| |||||| | |||||||||||    
T  3829031 aatgtgcaaaaattatcgatcgaacccgagcgaccgtccggggttgccgggtgatgaaaccgccc 3828967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 41972395 - 41972458
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||||||||||||||||||||| || |||||| |||||||||||| || ||||| ||||||||    
T  41972395 aatgtgcaaaaattatcgatcgag-ccaggcgaccgcccggggtcgctggacggtggaaccgccc 41972458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 32982176 - 32982223
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgcc 48  Q
    |||||||||||||||||||||| ||||| ||||| |||||||||||||    
T  32982176 aatgtgcaaaaattatcgatcgggcccgcgcgaccgcccggggtcgcc 32982223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 7 - 65
Target Start/End: Original strand, 321503 - 321561
Alignment:
Q  7 caaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    ||||||||||||||||||||||| |||| |||||   |||||||| |||||||||||||    
T  321503 caaaaattatcgatcgagcccggacgaccgcccgaaatcgccgggtggtgaaaccgccc 321561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 17445360 - 17445296
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    ||||| |||||||||| |||| |||||||||||| ||  |||||||||||||  |||||||||||    
T  17445360 aatgtacaaaaattattgatccagcccgggcgaccgcatggggtcgccgggcaatgaaaccgccc 17445296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 42311061 - 42311093
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcga 33  Q
    |||||||||||||||||||||||||||||||||    
T  42311061 aatgtgcaaaaattatcgatcgagcccgggcga 42311093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 7433492 - 7433425
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatg 68  Q
    |||||||||||||||| |||||||| |||||||| ||||||||| |||   ||||  |||||||||||    
T  7433492 aatgtgcaaaaattatagatcgagctcgggcgaccgcccggggttgccatacggtagaaccgcccatg 7433425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 36 - 64
Target Start/End: Complemental strand, 10907641 - 10907613
Alignment:
Q  36 gcccggggtcgccgggcggtgaaaccgcc 64  Q
    |||||||||||||||||||||||||||||    
T  10907641 gcccggggtcgccgggcggtgaaaccgcc 10907613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 33489734 - 33489670
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    ||||| ||||||||||||| | | ||||  |||| | |||||||||||||| |||||||||||||    
T  33489734 aatgtacaaaaattatcgaacaatcccgaacgaccgtccggggtcgccgggtggtgaaaccgccc 33489670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 48901225 - 48901288
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||||| |||||||||||||| ||| ||| || |||||| || ||||||||||| ||||||||    
T  48901225 aatgtgcataaattatcgatcga-ccccggccaccgcccggagttgccgggcggtggaaccgccc 48901288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 57; Significance: 1e-23; HSPs: 33)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 6690355 - 6690419
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  6690355 aatgcgcaaaaattatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgccc 6690419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 43143704 - 43143771
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatg 68  Q
    |||||||||||||||||||||||||||||||||| ||||||||||| ||| |||||||||||||||||    
T  43143704 aatgtgcaaaaattatcgatcgagcccgggcgaccgcccggggtcgtcggacggtgaaaccgcccatg 43143771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 30216862 - 30216926
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| ||||||    
T  30216862 aatgtgcaaaaattatcgatcgagcccgggcgaccgcccggggtcgccggacggtgaatccgccc 30216926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 11 - 65
Target Start/End: Original strand, 49908782 - 49908836
Alignment:
Q  11 aattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  49908782 aattatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgccc 49908836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 7 - 68
Target Start/End: Complemental strand, 7769369 - 7769308
Alignment:
Q  7 caaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatg 68  Q
    |||||||||||||||||||||||||||| ||| ||||||||||| |||||||||||||||||    
T  7769369 caaaaattatcgatcgagcccgggcgaccgcctggggtcgccggacggtgaaaccgcccatg 7769308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 3293016 - 3293080
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||| ||||||||||||||||||||||||||||| |||||||||| | |||||||||||||||||    
T  3293016 aatgggcaaaaattatcgatcgagcccgggcgaccgcccggggtcactgggcggtgaaaccgccc 3293080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 10353004 - 10353068
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||||||||||||||||| ||||||||||||| ||| ||||||||||| ||||||||||||||    
T  10353004 aatgtgcaaaaattatcgattgagcccgggcgaccgccaggggtcgccggacggtgaaaccgccc 10353068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 50205197 - 50205261
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    ||||||||||||||||||||||||| |||||||| ||||||| ||||||| ||||||||||||||    
T  50205197 aatgtgcaaaaattatcgatcgagctcgggcgaccgcccgggatcgccggacggtgaaaccgccc 50205261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 11 - 65
Target Start/End: Original strand, 5517494 - 5517548
Alignment:
Q  11 aattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    ||||||||||||||||| |||||| ||||||||||||||||||||||||||||||    
T  5517494 aattatcgatcgagcccaggcgaccgcccggggtcgccgggcggtgaaaccgccc 5517548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 13012235 - 13012168
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatg 68  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||    ||||| |||||||||||    
T  13012235 aatgtgcaaaaattatcgatcgagcccgggcgaccgcccggggtcgctacacggtggaaccgcccatg 13012168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 20129357 - 20129290
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatg 68  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||    ||||| |||||||||||    
T  20129357 aatgtgcaaaaattatcgatcgagcccgggcgaccgcccggggtcgctacacggtggaaccgcccatg 20129290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 47500820 - 47500753
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatg 68  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||    ||||| |||||||||||    
T  47500820 aatgtgcaaaaattatcgatcgagcccgggcgaccgcccggggtcgctacacggtggaaccgcccatg 47500753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 30110003 - 30109945
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaa 59  Q
    |||||||||||||||||||||||| ||||||||| | ||||||||| ||||||||||||    
T  30110003 aatgtgcaaaaattatcgatcgagtccgggcgaccgtccggggtcgtcgggcggtgaaa 30109945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 34407404 - 34407473
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatgcc 70  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||    ||||| |||||||||||||    
T  34407404 aatgtgcaaaaattatcgaccgagcccgggcgaccgcccggggtcgctacacggtggaaccgcccatgcc 34407473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 26448100 - 26448036
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||||||||||||||||||||| |||| |||  || ||| |||||||||||||||||||||||    
T  26448100 aatgtgcaaaaattatcgatcgagtccggacgatcgcacggagtcgccgggcggtgaaaccgccc 26448036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 43355951 - 43355883
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatgc 69  Q
    ||||||||||||||||||| |||||||||||||||||| ||||||||    ||||| ||||||||||||    
T  43355951 aatgtgcaaaaattatcgaccgagcccgggcgactgcctggggtcgctacacggtggaaccgcccatgc 43355883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 26439399 - 26439466
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatg 68  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||    ||||| |||||||||||    
T  26439399 aatgtgcaaaaattatcgaccgagcccgggcgaccgcccggggtcgctacacggtggaaccgcccatg 26439466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 36382465 - 36382512
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgcc 48  Q
    |||||||||||||||| ||||||||||||||||| |||||||||||||    
T  36382465 aatgtgcaaaaattatggatcgagcccgggcgaccgcccggggtcgcc 36382512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 42333896 - 42333963
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatg 68  Q
    |||||||||||||||||||| |||||||| |||| ||||||| |||| || ||||||||||| |||||    
T  42333896 aatgtgcaaaaattatcgattgagcccggacgaccgcccgggatcgctggacggtgaaaccgtccatg 42333963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 12 - 65
Target Start/End: Original strand, 6212029 - 6212082
Alignment:
Q  12 attatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||||||||||| |||||||| ||||| ||||||||| ||||||||||||||    
T  6212029 attatcgatcgagctcgggcgaccgcccgaggtcgccggacggtgaaaccgccc 6212082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 5 - 70
Target Start/End: Original strand, 13392994 - 13393059
Alignment:
Q  5 tgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatgcc 70  Q
    ||||||| | |||||| ||||||||||||| | |||||||||| ||||||||||||||||| ||||    
T  13392994 tgcaaaagtcatcgattgagcccgggcgaccgtccggggtcgctgggcggtgaaaccgcccctgcc 13393059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 5 - 70
Target Start/End: Original strand, 13396133 - 13396198
Alignment:
Q  5 tgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatgcc 70  Q
    ||||||| | |||||| ||||||||||||| | |||||||||| ||||||||||||||||| ||||    
T  13396133 tgcaaaagtcatcgattgagcccgggcgaccgtccggggtcgctgggcggtgaaaccgcccctgcc 13396198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 12 - 65
Target Start/End: Complemental strand, 17555032 - 17554979
Alignment:
Q  12 attatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||||||||||||||||||||  |||||||||| ||| ||||||||||||||    
T  17555032 attatcgatcgagcccgggcgaccacccggggtcgtcggacggtgaaaccgccc 17554979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 5 - 71
Target Start/End: Complemental strand, 48130009 - 48129947
Alignment:
Q  5 tgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatgcca 71  Q
    ||||||||||||||||||||||||| ||||    || |||||||||||||| |||||||||||||||    
T  48130009 tgcaaaaattatcgatcgagcccggtcgac----cgaggtcgccgggcggttaaaccgcccatgcca 48129947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 11 - 64
Target Start/End: Original strand, 50720476 - 50720529
Alignment:
Q  11 aattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcc 64  Q
    |||||| ||| ||||||||||||| ||||| |||||||||||||||||||||||    
T  50720476 aattattgattgagcccgggcgaccgcccgaggtcgccgggcggtgaaaccgcc 50720529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 29996103 - 29996167
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    ||||| |||||||||||||||||| |||| |||| | ||||| ||| ||||||||||||||||||    
T  29996103 aatgtacaaaaattatcgatcgagtccggacgaccgtccgggatcgtcgggcggtgaaaccgccc 29996167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 30077751 - 30077814
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    ||||||||||| |||||||| ||||| ||||||| ||||| ||||| ||||||||||||||||||    
T  30077751 aatgtgcaaaatttatcgattgagcctgggcgaccgcccgaggtcg-cgggcggtgaaaccgccc 30077814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 48989375 - 48989311
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    ||||||||||||||||||||||| |||||  ||| |||||| |||| ||||||||||||| ||||    
T  48989375 aatgtgcaaaaattatcgatcgaacccggttgaccgcccggagtcgtcgggcggtgaaactgccc 48989311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 25930755 - 25930688
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatg 68  Q
    |||||||||||||||| ||||||||||||||||| |||| ||||||||   ||||  |||||||||||    
T  25930755 aatgtgcaaaaattatagatcgagcccgggcgaccgcccagggtcgccatacggtagaaccgcccatg 25930688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 28877370 - 28877440
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatgcca 71  Q
    ||||||||||||||||||||| |||||  ||||| || |||||||  ||| |||||||||||||| |||||    
T  28877370 aatgtgcaaaaattatcgatctagcccaagcgaccgcacggggtcatcggacggtgaaaccgcccctgcca 28877440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 12 - 65
Target Start/End: Original strand, 12680193 - 12680246
Alignment:
Q  12 attatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||||||||||||||||| || ||| ||||| || |||||||||||||||||    
T  12680193 attatcgatcgagcccgggccaccgcctggggttgctgggcggtgaaaccgccc 12680246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 45194223 - 45194159
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||||||||||||| ||||||| |||||| |  ||| ||||||| ||||||||||||| ||||    
T  45194223 aatgtgcaaaaattattgatcgagtccgggcaatcgcctggggtcgtcgggcggtgaaactgccc 45194159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 29319825 - 29319869
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtc 45  Q
    |||||||||||||||||||||||||| || |||| ||| ||||||    
T  29319825 aatgtgcaaaaattatcgatcgagcctggacgaccgccaggggtc 29319869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 57; Significance: 1e-23; HSPs: 18)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 45183028 - 45182964
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  45183028 aatgcgcaaaaattatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgccc 45182964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 5 - 69
Target Start/End: Original strand, 6503693 - 6503757
Alignment:
Q  5 tgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatgc 69  Q
    ||||||||| |||||||||||||||||||| ||||||||||||||| ||||||||||||||||||    
T  6503693 tgcaaaaataatcgatcgagcccgggcgaccgcccggggtcgccggacggtgaaaccgcccatgc 6503757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 6931014 - 6931078
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||| ||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||    
T  6931014 aatgcgcaaaaattatcgatcgagcccgggcgaccgtccggggtcgccgggcggtgaaaccgccc 6931078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 11018332 - 11018399
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatg 68  Q
    |||||||||||||||||||||||||| ||||||| |||||| |||||||| |||||||||||||||||    
T  11018332 aatgtgcaaaaattatcgatcgagcctgggcgaccgcccggagtcgccggacggtgaaaccgcccatg 11018399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 27935225 - 27935158
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatg 68  Q
    ||||||||||||||||||||||||||||||||||||||| |||| ||| |||||||||||| ||||||    
T  27935225 aatgtgcaaaaattatcgatcgagcccgggcgactgcccagggttgccaggcggtgaaaccacccatg 27935158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 19565621 - 19565685
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||||||||||||||||| || |||||||||| ||||||| ||||||||||||||||||||||    
T  19565621 aatgtgcaaaaattatcgattgaacccgggcgaccgcccgggatcgccgggcggtgaaaccgccc 19565685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 5 - 65
Target Start/End: Complemental strand, 33040996 - 33040936
Alignment:
Q  5 tgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    ||||||||||||| |||||||||| ||||| ||||||||||||||||||||||||||||||    
T  33040996 tgcaaaaattatcaatcgagcccgagcgaccgcccggggtcgccgggcggtgaaaccgccc 33040936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 11 - 65
Target Start/End: Complemental strand, 6891035 - 6890981
Alignment:
Q  11 aattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||||||||||||||||||||| |||||| |||||||||||||||||||||||    
T  6891035 aattatcgatcgagcccgggcgaccgcccggtgtcgccgggcggtgaaaccgccc 6890981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 45335922 - 45335858
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||| ||||||||||||| ||| ||||||||| ||||| ||||||||||||||||||||||||    
T  45335922 aatgtgtaaaaattatcgattgagtccgggcgaccgcccgaggtcgccgggcggtgaaaccgccc 45335858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 9 - 65
Target Start/End: Complemental strand, 5354748 - 5354692
Alignment:
Q  9 aaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||||  ||||||||||||||||| ||||||||||||||||||||||||| ||||    
T  5354748 aaaattaaggatcgagcccgggcgaccgcccggggtcgccgggcggtgaaactgccc 5354692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 9 - 65
Target Start/End: Complemental strand, 35514305 - 35514249
Alignment:
Q  9 aaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    ||||||||||||||||||||| |||| | ||||||||||||||||||||||| ||||    
T  35514305 aaaattatcgatcgagcccggacgaccgtccggggtcgccgggcggtgaaactgccc 35514249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 34084242 - 34084289
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgcc 48  Q
    |||||||||||||||||||||||| ||||||||| |||||||||||||    
T  34084242 aatgtgcaaaaattatcgatcgagtccgggcgaccgcccggggtcgcc 34084289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 39771837 - 39771770
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatg 68  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||    ||||| |||||||||||    
T  39771837 aatgtgcaaaaattatcgaccgagcccgggcgaccgcccggggtcgctacacggtggaaccgcccatg 39771770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 22968564 - 22968610
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgc 47  Q
    ||||||||||||||||||||||||||||| |||| ||||||||||||    
T  22968564 aatgtgcaaaaattatcgatcgagcccggacgaccgcccggggtcgc 22968610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 19390193 - 19390146
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgcc 48  Q
    ||||||||||||||||||||||| ||||| |||| |||||||||||||    
T  19390193 aatgtgcaaaaattatcgatcgaacccggacgaccgcccggggtcgcc 19390146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 22922204 - 22922157
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgcc 48  Q
    ||||||||||||| |||||||||||||| ||||| ||||||| |||||    
T  22922204 aatgtgcaaaaatgatcgatcgagcccgagcgaccgcccgggatcgcc 22922157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 6269546 - 6269592
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgc 47  Q
    |||||||||||||||||||||||| |||| |||| ||||||| ||||    
T  6269546 aatgtgcaaaaattatcgatcgagtccggacgaccgcccgggatcgc 6269592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 40081859 - 40081892
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgac 34  Q
    ||||| ||||||||||||||||||||||||||||    
T  40081859 aatgttcaaaaattatcgatcgagcccgggcgac 40081892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 53; Significance: 3e-21; HSPs: 12)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 2729316 - 2729380
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||| ||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||    
T  2729316 aatgtgtaaaaattatcgatcgagcccgggcgtccgcccggggtcgccgggcggtgaaaccgccc 2729380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 5 - 65
Target Start/End: Complemental strand, 23402151 - 23402091
Alignment:
Q  5 tgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  23402151 tgcaaagattatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgccc 23402091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 36408598 - 36408538
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaacc 61  Q
    |||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||    
T  36408598 aatgtgcaaaaattatcgatcgagcccgggcgaccgcccgaggtcgccgggcggtgaaacc 36408538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 4404055 - 4403988
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatg 68  Q
    |||||||||||||||||||||||||||||||||| ||| ||||||||||| | ||||||||| |||||    
T  4404055 aatgtgcaaaaattatcgatcgagcccgggcgaccgcctggggtcgccggccagtgaaaccgtccatg 4403988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 34136945 - 34137012
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatg 68  Q
    |||||||||||||||||||||||||||||||||| || |||||||||| | |||||||||| ||||||    
T  34136945 aatgtgcaaaaattatcgatcgagcccgggcgaccgctcggggtcgccagacggtgaaaccacccatg 34137012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 16788145 - 16788206
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccg 62  Q
    |||||||||||||||||||||||||||||||||| ||||||||| |||||||  ||||||||    
T  16788145 aatgtgcaaaaattatcgatcgagcccgggcgaccgcccggggttgccgggcaatgaaaccg 16788206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 69 - 117
Target Start/End: Original strand, 39977576 - 39977624
Alignment:
Q  69 ccaccaccattggctgcaatttttctgaaagcacgatgacaaccacaac 117  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||    
T  39977576 ccaccaccattggctgcaatttttctgaaagcatgatgacaaccacaac 39977624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 39914562 - 39914516
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgc 47  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||    
T  39914562 aatgtgcaaaaattatcgatcgagcccgggcgaccgcccggggtcgc 39914516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 10397160 - 10397220
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaacc 61  Q
    |||||| | ||||||||||| |||||||||||| ||||||| |||||||||||||| ||||    
T  10397160 aatgtgaagaaattatcgattgagcccgggcgagtgcccggagtcgccgggcggtgtaacc 10397220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 15838333 - 15838286
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgcc 48  Q
    ||||||||||||||||| |||||||||||| ||| |||||||||||||    
T  15838333 aatgtgcaaaaattatcaatcgagcccgggtgaccgcccggggtcgcc 15838286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 3648914 - 3648949
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactg 36  Q
    |||||| |||||||||||||||||||||||||||||    
T  3648914 aatgtgaaaaaattatcgatcgagcccgggcgactg 3648949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 29728506 - 29728553
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgcc 48  Q
    ||||||||||| ||||||||||||| |||||||| | |||||||||||    
T  29728506 aatgtgcaaaatttatcgatcgagcacgggcgaccgtccggggtcgcc 29728553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 53; Significance: 3e-21; HSPs: 10)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 28996777 - 28996713
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||| |||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||    
T  28996777 aatgcgcaaaaattatcgatcgagctcgggcgaccgcccggggtcgccgggcggtgaaaccgccc 28996713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 24697937 - 24698000
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcc 64  Q
    |||||| ||||||||||||| |||||||||||| || |||||||||||||||||||||||||||    
T  24697937 aatgtgaaaaaattatcgattgagcccgggcgagtgtccggggtcgccgggcggtgaaaccgcc 24698000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 12 - 65
Target Start/End: Complemental strand, 13647053 - 13647000
Alignment:
Q  12 attatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    ||||||||||||||||||||||| |||||||||||||||| |||||||||||||    
T  13647053 attatcgatcgagcccgggcgaccgcccggggtcgccgggtggtgaaaccgccc 13647000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 31028484 - 31028545
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccg 62  Q
    |||||||||||||||||||||||| |||||| || || ||||||||||||||||||||||||    
T  31028484 aatgtgcaaaaattatcgatcgagtccgggcaaccgctcggggtcgccgggcggtgaaaccg 31028545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 398664 - 398597
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatg 68  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||    ||||| |||||||||||    
T  398664 aatgtgcaaaaattatcgatcgagcccgggcgaccgcccggggtcgctacacggtggaaccgcccatg 398597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 12 - 65
Target Start/End: Original strand, 34385519 - 34385572
Alignment:
Q  12 attatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    ||||||||||||||| |||| || ||||||||||||||||||||||||||||||    
T  34385519 attatcgatcgagccagggcaaccgcccggggtcgccgggcggtgaaaccgccc 34385572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 29743330 - 29743266
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||||||||||||||||| |||||||||| || ||||||| ||| ||| ||||||||||||||    
T  29743330 aatgtgcaaaaattatcgattgagcccgggcaaccgcccgggatcgtcggacggtgaaaccgccc 29743266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 18339153 - 18339106
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgcc 48  Q
    |||||||||||||||| ||||||||||||||||| |||||||||||||    
T  18339153 aatgtgcaaaaattattgatcgagcccgggcgaccgcccggggtcgcc 18339106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 34948878 - 34948947
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatgcc 70  Q
    |||||||||||||||||||||||||| ||||||| ||| |||||||||   ||||  |||||||||||||    
T  34948878 aatgtgcaaaaattatcgatcgagcctgggcgaccgcctggggtcgccatacggtagaaccgcccatgcc 34948947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 11 - 65
Target Start/End: Original strand, 21149331 - 21149385
Alignment:
Q  11 aattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    ||||||||||| |||||| ||||| ||||| |||| |||||||||||||| ||||    
T  21149331 aattatcgatcaagcccgagcgaccgcccgaggtcaccgggcggtgaaactgccc 21149385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0154 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: scaffold0154
Description:

Target: scaffold0154; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 3 - 65
Target Start/End: Complemental strand, 31525 - 31463
Alignment:
Q  3 tgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    |||||||||||||||||||||||||||||||| | | |||||||||||||| |||||||||||    
T  31525 tgtgcaaaaattatcgatcgagcccgggcgaccgtctggggtcgccgggcgatgaaaccgccc 31463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 480577 - 480645
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatgc 69  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||    ||||| ||||||||||||    
T  480577 aatgtgcaaaaattatcgatcgagcccgggcgaccgcccggggtcgctacacggtggaaccgcccatgc 480645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold2142 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold2142
Description:

Target: scaffold2142; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 569 - 502
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatg 68  Q
    |||||||||||||||||||||||||||||||||| ||||||| ||||    ||||| |||||||||||    
T  569 aatgtgcaaaaattatcgatcgagcccgggcgaccgcccgggatcgctacacggtggaaccgcccatg 502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0769 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0769
Description:

Target: scaffold0769; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 18 - 65
Target Start/End: Complemental strand, 1307 - 1260
Alignment:
Q  18 gatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgccc 65  Q
    ||||||||||||||||| |||||||||||||||||||| |||||||||    
T  1307 gatcgagcccgggcgaccgcccggggtcgccgggcggtaaaaccgccc 1260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0502 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0502
Description:

Target: scaffold0502; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 5277 - 5230
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgcc 48  Q
    |||||||||||||||| ||||||||||||||||| |||||||||||||    
T  5277 aatgtgcaaaaattattgatcgagcccgggcgaccgcccggggtcgcc 5230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0012 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0012
Description:

Target: scaffold0012; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 55
Target Start/End: Complemental strand, 194058 - 194021
Alignment:
Q  18 gatcgagcccgggcgactgcccggggtcgccgggcggt 55  Q
    ||||||||||||||||| ||||||||||||||||||||    
T  194058 gatcgagcccgggcgaccgcccggggtcgccgggcggt 194021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0069 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0069
Description:

Target: scaffold0069; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 17889 - 17822
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccatg 68  Q
    ||||||||||||||||||||||||||||| |||  || ||||||||||   ||||  |||||||||||    
T  17889 aatgtgcaaaaattatcgatcgagcccggacgatcgctcggggtcgccacacggtagaaccgcccatg 17822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0041
Description:

Target: scaffold0041; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 52972 - 52944
Alignment:
Q  1 aatgtgcaaaaattatcgatcgagcccgg 29  Q
    |||||||||||||||||||||||||||||    
T  52972 aatgtgcaaaaattatcgatcgagcccgg 52944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University