View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11745_high_210 (Length: 233)

Name: NF11745_high_210
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11745_high_210
NF11745_high_210
[»] chr6 (1 HSPs)
chr6 (16-156)||(33781221-33781361)


Alignment Details
Target: chr6 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 16 - 156
Target Start/End: Complemental strand, 33781361 - 33781221
Alignment:
Q  16 taggggattacaaagaagggtattatattggagttgaagtagatgaagatgacccagaatcaaataaacccttttatgggcctaataaatggcctgcacc 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33781361 taggggattacaaagaagggtattatattggagttgaagtagatgaagatgacccagaatcaaataaacccttttatgggcctaataaatggcctgcacc 33781262  T
Q  116 aggtaaagagttaaaaaacttacctttagaggaaaaatatg 156  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  33781261 aggtaaagagttaaaaaacttacctttagaggaaaaatatg 33781221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University