View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11742_low_14 (Length: 203)

Name: NF11742_low_14
Description: NF11742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11742_low_14
NF11742_low_14
[»] chr1 (1 HSPs)
chr1 (17-187)||(14208247-14208415)


Alignment Details
Target: chr1 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 17 - 187
Target Start/End: Complemental strand, 14208415 - 14208247
Alignment:
Q  17 agagatttagttgggatgaagaagatgattatatatttgtttaatatgaggcggtgaaagaagagacaaatgattagatattttaggatgaggatgaaga 116  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| ||||||||||||||    
T  14208415 agagatttagttgggatgaagaagacgattatatatttgtttaatatgaggcggtggaagaagagacaaataattagatattttaagatgaggatgaaga 14208316  T
Q  117 agagccnnnnnnnnnnnttaatctttcaatttggtccctatgacgtgtcgttgcgtatatggggtttaaat 187  Q
    ||| ||           ||||||||||| ||||| ||||||||| |||||||| |||||||||||||||||    
T  14208315 agaccc--aaaaaaaaattaatctttcagtttggcccctatgacatgtcgttgtgtatatggggtttaaat 14208247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University